EMAIL THIS PAGE TO A FRIEND

TTC7A

tetratricopeptide repeat domain 7A

Synonyms: MINAT TTC7
UniProtKB ID: Q9ULT0, Q6PIX4, Q8ND67, Q9BUS3
Gene ID:
Human(57217) Summary: The tetratricopeptide repeat (TPR) domain is defined by a degenerate consensus sequence of 34 amino acids. TPR domain-containing proteins, such as TTC7A, have diverse functions in cell cycle control, protein transport, phosphate turnover, and protein trafficking or secretion, and they can act as chaperones or scaffolding proteins (White et al., 2005 [PubMed 15718100]
Rat(362696) tetratricopeptide repeat domain 7A
cow(616640) tetratricopeptide repeat domain 7A
sheep(101108206) tetratricopeptide repeat domain 7A
domestic guinea pig(100723745) tetratricopeptide repeat domain 7A
Domestic Rabbit(100352649) tetratricopeptide repeat domain 7A
naked mole-rat(101703669) tetratricopeptide repeat domain 7A
Zebrafish(559345) tetratricopeptide repeat domain 7A
chicken(421414) tetratricopeptide repeat domain 7A
Horse(100068276) tetratricopeptide repeat domain 7A
domestic cat(101081033) tetratricopeptide repeat domain 7A
dog(474583) tetratricopeptide repeat domain 7A
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020458 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085081 MISSION® esiRNA esiRNA human TTC7A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020458 Rosetta Predictions human pricing
NM_001100756 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126304 predicted 807
2 SASI_Hs02_00353504 predicted 2168
3 SASI_Hs02_00353505 predicted 653
4 SASI_Hs01_00126305 predicted 1191
5 SASI_Hs01_00126306 predicted 1769
6 SASI_Hs01_00126307 predicted 1578
7 SASI_Hs02_00353506 predicted 2588
8 SASI_Hs01_00126308 predicted 1594
9 SASI_Hs01_00126309 predicted 998
10 SASI_Hs01_00126310 predicted 810
11 SASI_Hs01_00126311 predicted 1299
12 SASI_Hs01_00126312 predicted 1195
13 SASI_Hs01_00126313 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210478 predicted 1657
2 SASI_Rn02_00210479 predicted 2895
3 SASI_Rn02_00210480 predicted 892
4 SASI_Rn02_00210481 predicted 1466
5 SASI_Rn02_00210482 predicted 572
6 SASI_Rn02_00210483 predicted 911
7 SASI_Rn02_00210484 predicted 479
8 SASI_Rn02_00210485 predicted 2311
9 SASI_Rn02_00210486 predicted 718
10 SASI_Rn02_00210487 predicted 1436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020458
TTC7A MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 7A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1895s1c1
Sequence:CCGGGCAAGATGAATTGCACCGGAACTCGAGTTCCGGTGCAATTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020458.1-1597s1c1
Sequence:CCGGCGTTTGGAGAATTTCACCTTTCTCGAGAAAGGTGAAATTCTCCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1581s1c1
Sequence:CCGGCGAGCCATGAAGTTTGCGTTTCTCGAGAAACGCAAACTTCATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1884s1c1
Sequence:CCGGCTGAAGTCCAAGCAAGATGAACTCGAGTTCATCTTGCTTGGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1186s1c1
Sequence:CCGGCCAAAGCAACTCAGAACTTCACTCGAGTGAAGTTCTGAGTTGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-551s1c1
Sequence:CCGGCGATGACTTTGGGAAATTGCTCTCGAGAGCAATTTCCCAAAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020458
TTC7A MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 7A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1895s1c1
Sequence:CCGGGCAAGATGAATTGCACCGGAACTCGAGTTCCGGTGCAATTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020458.1-1597s1c1
Sequence:CCGGCGTTTGGAGAATTTCACCTTTCTCGAGAAAGGTGAAATTCTCCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1581s1c1
Sequence:CCGGCGAGCCATGAAGTTTGCGTTTCTCGAGAAACGCAAACTTCATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1884s1c1
Sequence:CCGGCTGAAGTCCAAGCAAGATGAACTCGAGTTCATCTTGCTTGGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1186s1c1
Sequence:CCGGCCAAAGCAACTCAGAACTTCACTCGAGTGAAGTTCTGAGTTGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-551s1c1
Sequence:CCGGCGATGACTTTGGGAAATTGCTCTCGAGAGCAATTTCCCAAAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020458
TTC7A MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 7A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1895s1c1
Sequence:CCGGGCAAGATGAATTGCACCGGAACTCGAGTTCCGGTGCAATTCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020458.1-1597s1c1
Sequence:CCGGCGTTTGGAGAATTTCACCTTTCTCGAGAAAGGTGAAATTCTCCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1581s1c1
Sequence:CCGGCGAGCCATGAAGTTTGCGTTTCTCGAGAAACGCAAACTTCATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1884s1c1
Sequence:CCGGCTGAAGTCCAAGCAAGATGAACTCGAGTTCATCTTGCTTGGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-1186s1c1
Sequence:CCGGCCAAAGCAACTCAGAACTTCACTCGAGTGAAGTTCTGAGTTGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020458.1-551s1c1
Sequence:CCGGCGATGACTTTGGGAAATTGCTCTCGAGAGCAATTTCCCAAAGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks