EMAIL THIS PAGE TO A FRIEND

TTC7B

tetratricopeptide repeat domain 7B

Synonyms: TTC7L1 c14_5685
UniProtKB ID: Q86TV6, Q86U24, Q86VT3
Gene ID:
Mouse(104718) tetratricopeptide repeat domain 7B
Rat(362768) tetratricopeptide repeat domain 7B
Zebrafish(568039) tetratricopeptide repeat domain 7B
chicken(423407) tetratricopeptide repeat domain 7B
Horse(100062817) tetratricopeptide repeat domain 7B
domestic cat(101094934) tetratricopeptide repeat domain 7B
dog(480417) tetratricopeptide repeat domain 7B
naked mole-rat(101712902) tetratricopeptide repeat domain 7B
Domestic Rabbit(100348779) tetratricopeptide repeat domain 7B
domestic guinea pig(100725216) tetratricopeptide repeat domain 7B
cow(616909) tetratricopeptide repeat domain 7B
sheep(101115465) tetratricopeptide repeat domain 7B
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010854 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010854 Rosetta Predictions human pricing
NM_001108719 Rosetta Predictions rat pricing
XM_127105 Rosetta Predictions mouse pricing
XM_985528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024360 predicted 1290
2 SASI_Hs01_00024361 predicted 932
3 SASI_Hs01_00024362 predicted 1611
4 SASI_Hs01_00024364 predicted 2004
5 SASI_Hs01_00024365 predicted 1049
6 SASI_Hs01_00024366 predicted 384
7 SASI_Hs01_00024367 predicted 673
8 SASI_Hs01_00024368 predicted 551
9 SASI_Hs01_00024369 predicted 1108
10 SASI_Hs02_00305793 predicted 564
11 SASI_Hs01_00024363 predicted 2047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241405 predicted 1150
2 SASI_Rn02_00241406 predicted 1044
3 SASI_Rn02_00241407 predicted 1165
4 SASI_Rn02_00241408 predicted 856
5 SASI_Rn02_00241409 predicted 937
6 SASI_Rn02_00241410 predicted 336
7 SASI_Rn02_00241411 predicted 1417
8 SASI_Rn02_00241412 predicted 683
9 SASI_Rn02_00241413 predicted 1583
10 SASI_Rn02_00241414 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279644 predicted 1322
2 SASI_Mm01_00279645 predicted 572
3 SASI_Mm01_00279646 predicted 2081
4 SASI_Mm01_00279647 predicted 1422
5 SASI_Mm01_00279648 predicted 2430
6 SASI_Mm01_00279649 predicted 2089
7 SASI_Mm01_00279650 predicted 703
8 SASI_Mm01_00279651 predicted 1972
9 SASI_Mm01_00279652 predicted 706
10 SASI_Mm01_00279653 predicted 2268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448769 predicted 1168
2 SASI_Mm02_00448770 predicted 439
3 SASI_Mm02_00448771 predicted 1926
4 SASI_Mm02_00448772 predicted 1258
5 SASI_Mm02_00448773 predicted 2273
6 SASI_Mm02_00448774 predicted 1935
7 SASI_Mm02_00448775 predicted 566
8 SASI_Mm02_00448776 predicted 1812
9 SASI_Mm02_00448777 predicted 581
10 SASI_Mm02_00448778 predicted 2120
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010854
VALIDATED
TTC7B MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 7B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010854.1-1206s1c1
Sequence:CCGGGCATCTGTGGTCTATGACTTACTCGAGTAAGTCATAGACCACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-3136s1c1
Sequence:CCGGCCAGCTGACAATTTCTTGGTTCTCGAGAACCAAGAAATTGTCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-3247s1c1
Sequence:CCGGGCCTGTTACAAGAGAAGGAAACTCGAGTTTCCTTCTCTTGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-1952s1c1
Sequence:CCGGGCAGATATGGAAATCCTGCTACTCGAGTAGCAGGATTTCCATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-574s1c1
Sequence:CCGGGTTTGGAGAAGCTGCCTATTTCTCGAGAAATAGGCAGCTTCTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-557s1c1
Sequence:CCGGCGCTACCAAAGGACTTTGTTTCTCGAGAAACAAAGTCCTTTGGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-2821s1c1
Sequence:CCGGCCATGTGCGTTTCTCTTGTTTCTCGAGAAACAAGAGAAACGCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-3078s1c1
Sequence:CCGGCCAGAAACCAAATGTGAACTTCTCGAGAAGTTCACATTTGGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-407s1c1
Sequence:CCGGCCTACAAGAATCCAATCTGATCTCGAGATCAGATTGGATTCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010854
VALIDATED
TTC7B MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 7B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010854.1-1206s1c1
Sequence:CCGGGCATCTGTGGTCTATGACTTACTCGAGTAAGTCATAGACCACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-3136s1c1
Sequence:CCGGCCAGCTGACAATTTCTTGGTTCTCGAGAACCAAGAAATTGTCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-3247s1c1
Sequence:CCGGGCCTGTTACAAGAGAAGGAAACTCGAGTTTCCTTCTCTTGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-1952s1c1
Sequence:CCGGGCAGATATGGAAATCCTGCTACTCGAGTAGCAGGATTTCCATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-574s1c1
Sequence:CCGGGTTTGGAGAAGCTGCCTATTTCTCGAGAAATAGGCAGCTTCTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-557s1c1
Sequence:CCGGCGCTACCAAAGGACTTTGTTTCTCGAGAAACAAAGTCCTTTGGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-2821s1c1
Sequence:CCGGCCATGTGCGTTTCTCTTGTTTCTCGAGAAACAAGAGAAACGCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-3078s1c1
Sequence:CCGGCCAGAAACCAAATGTGAACTTCTCGAGAAGTTCACATTTGGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-407s1c1
Sequence:CCGGCCTACAAGAATCCAATCTGATCTCGAGATCAGATTGGATTCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010854
VALIDATED
TTC7B MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 7B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010854.1-1206s1c1
Sequence:CCGGGCATCTGTGGTCTATGACTTACTCGAGTAAGTCATAGACCACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-3136s1c1
Sequence:CCGGCCAGCTGACAATTTCTTGGTTCTCGAGAACCAAGAAATTGTCAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-3247s1c1
Sequence:CCGGGCCTGTTACAAGAGAAGGAAACTCGAGTTTCCTTCTCTTGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-1952s1c1
Sequence:CCGGGCAGATATGGAAATCCTGCTACTCGAGTAGCAGGATTTCCATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-574s1c1
Sequence:CCGGGTTTGGAGAAGCTGCCTATTTCTCGAGAAATAGGCAGCTTCTCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-557s1c1
Sequence:CCGGCGCTACCAAAGGACTTTGTTTCTCGAGAAACAAAGTCCTTTGGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146381    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-2821s1c1
Sequence:CCGGCCATGTGCGTTTCTCTTGTTTCTCGAGAAACAAGAGAAACGCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001010854.1-3078s1c1
Sequence:CCGGCCAGAAACCAAATGTGAACTTCTCGAGAAGTTCACATTTGGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001010854.1-407s1c1
Sequence:CCGGCCTACAAGAATCCAATCTGATCTCGAGATCAGATTGGATTCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033213
VALIDATED
TTC7B MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 7B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-2772s21c1
Sequence:CCGGATGTAACCAGAGTGGATTAACCTCGAGGTTAATCCACTCTGGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033213.1-2305s21c1
Sequence:CCGGTCTTCCCAATGTCCCATAATGCTCGAGCATTATGGGACATTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-600s21c1
Sequence:CCGGGTTTCGTCCTCTACCAGTAATCTCGAGATTACTGGTAGAGGACGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-452s21c1
Sequence:CCGGTTACGTGGAAGGAGATTATAACTCGAGTTATAATCTCCTTCCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-705s21c1
Sequence:CCGGAGGGTAATGCTAACTAATATTCTCGAGAATATTAGTTAGCATTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033213
VALIDATED
TTC7B MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 7B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-2772s21c1
Sequence:CCGGATGTAACCAGAGTGGATTAACCTCGAGGTTAATCCACTCTGGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033213.1-2305s21c1
Sequence:CCGGTCTTCCCAATGTCCCATAATGCTCGAGCATTATGGGACATTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-600s21c1
Sequence:CCGGGTTTCGTCCTCTACCAGTAATCTCGAGATTACTGGTAGAGGACGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-452s21c1
Sequence:CCGGTTACGTGGAAGGAGATTATAACTCGAGTTATAATCTCCTTCCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-705s21c1
Sequence:CCGGAGGGTAATGCTAACTAATATTCTCGAGAATATTAGTTAGCATTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033213
VALIDATED
TTC7B MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 7B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-2772s21c1
Sequence:CCGGATGTAACCAGAGTGGATTAACCTCGAGGTTAATCCACTCTGGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033213.1-2305s21c1
Sequence:CCGGTCTTCCCAATGTCCCATAATGCTCGAGCATTATGGGACATTGGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-600s21c1
Sequence:CCGGGTTTCGTCCTCTACCAGTAATCTCGAGATTACTGGTAGAGGACGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-452s21c1
Sequence:CCGGTTACGTGGAAGGAGATTATAACTCGAGTTATAATCTCCTTCCACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033213.1-705s21c1
Sequence:CCGGAGGGTAATGCTAACTAATATTCTCGAGAATATTAGTTAGCATTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks