EMAIL THIS PAGE TO A FRIEND

TTC8

tetratricopeptide repeat domain 8

Synonyms: BBS8 RP51
Gene ID:
Human(123016) Summary: This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is involved in the formation of cilia. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Mouse(76260) tetratricopeptide repeat domain 8
Rat(299246) tetratricopeptide repeat domain 8
cow(615652) tetratricopeptide repeat domain 8
sheep(101114448) tetratricopeptide repeat domain 8
domestic guinea pig(100723278) tetratricopeptide repeat domain 8
Domestic Rabbit(100350688) tetratricopeptide repeat domain 8
naked mole-rat(101717584) tetratricopeptide repeat domain 8
Zebrafish(678551) tetratricopeptide repeat domain 8
chicken(423401) tetratricopeptide repeat domain 8
dog(480413) tetratricopeptide repeat domain 8
Horse(100052922) tetratricopeptide repeat domain 8
domestic cat(101092443) tetratricopeptide repeat domain 8
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144596 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144596 Rosetta Predictions human pricing
NM_198309 Rosetta Predictions human pricing
NM_198310 Rosetta Predictions human pricing
NM_001106752 Rosetta Predictions rat pricing
NM_029553 Rosetta Predictions mouse pricing
NM_198311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053058 predicted 1173
2 SASI_Hs02_00364389 predicted 1492
3 SASI_Hs02_00364390 predicted 1141
4 SASI_Hs01_00053061 predicted 1407
5 SASI_Hs01_00053062 predicted 1418
6 SASI_Hs01_00053063 predicted 1095
7 SASI_Hs01_00053064 predicted 1479
8 SASI_Hs01_00053065 predicted 1520
9 SASI_Hs01_00053066 predicted 1535
10 SASI_Hs01_00053067 predicted 880
11 SASI_Hs01_00053059 predicted 1303
12 SASI_Hs01_00053060 predicted 1571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179738 predicted 1143
2 SASI_Hs02_00371862 predicted 1466
3 SASI_Hs02_00371863 predicted 1106
4 SASI_Hs01_00179741 predicted 1381
5 SASI_Hs01_00179742 predicted 1395
6 SASI_Hs01_00179743 predicted 1064
7 SASI_Hs01_00179744 predicted 1454
8 SASI_Hs01_00179745 predicted 1489
9 SASI_Hs01_00179746 predicted 1508
10 SASI_Hs01_00179747 predicted 854
11 SASI_Hs01_00179739 predicted 1265
12 SASI_Hs01_00179740 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155699 predicted 1055
2 SASI_Hs02_00371864 predicted 1373
3 SASI_Hs02_00371865 predicted 1014
4 SASI_Hs01_00155702 predicted 1288
5 SASI_Hs01_00155703 predicted 1303
6 SASI_Hs01_00155704 predicted 973
7 SASI_Hs01_00155705 predicted 1361
8 SASI_Hs01_00155706 predicted 1396
9 SASI_Hs01_00155707 predicted 1422
10 SASI_Hs01_00155708 predicted 763
11 SASI_Hs01_00155700 predicted 1177
12 SASI_Hs01_00155701 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222048 predicted 1115
2 SASI_Rn02_00222049 predicted 815
3 SASI_Rn02_00222050 predicted 413
4 SASI_Rn02_00222051 predicted 1075
5 SASI_Rn02_00222052 predicted 232
6 SASI_Rn02_00222053 predicted 378
7 SASI_Rn02_00222054 predicted 859
8 SASI_Rn02_00222055 predicted 711
9 SASI_Rn02_00222056 predicted 1153
10 SASI_Rn02_00222057 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163797 predicted 1157
2 SASI_Mm01_00163798 predicted 784
3 SASI_Mm01_00163800 predicted 982
4 SASI_Mm01_00163801 predicted 1685
5 SASI_Mm01_00163802 predicted 578
6 SASI_Mm01_00163803 predicted 896
7 SASI_Mm02_00335506 predicted 1535
8 SASI_Mm01_00163804 predicted 1437
9 SASI_Mm01_00163805 predicted 1043
10 SASI_Mm01_00163806 predicted 811
11 SASI_Mm01_00163799 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029370 predicted 1159
2 SASI_Mm01_00029371 predicted 789
3 SASI_Mm01_00029373 predicted 991
4 SASI_Mm01_00029374 predicted 1693
5 SASI_Mm01_00029375 predicted 581
6 SASI_Mm01_00029376 predicted 909
7 SASI_Mm02_00350942 predicted 1539
8 SASI_Mm01_00029377 predicted 1444
9 SASI_Mm01_00029378 predicted 1045
10 SASI_Mm01_00029379 predicted 814
11 SASI_Mm01_00029372 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144596
TTC8 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 8
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144596.2-2073s21c1
Sequence:CCGGGGTGGAGGTGGGAGGATTATACTCGAGTATAATCCTCCCACCTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-579s21c1
Sequence:CCGGAGTCCTGATGGACCATTTATACTCGAGTATAAATGGTCCATCAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144596.2-1730s21c1
Sequence:CCGGCCTGTCCTTGATATTAGTTAACTCGAGTTAACTAATATCAAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-976s21c1
Sequence:CCGGTCTATGAGGAAATGAACAATACTCGAGTATTGTTCATTTCCTCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-243s21c1
Sequence:CCGGGCGCTAACAGAAATGGTATACCTCGAGGTATACCATTTCTGTTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-1416s21c1
Sequence:CCGGGAACAGGCAAGGGCACTATTACTCGAGTAATAGTGCCCTTGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-1242s1c1
Sequence:CCGGCCTCATTTGAACGTGCCCTTTCTCGAGAAAGGGCACGTTCAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-580s1c1
Sequence:CCGGCCAGAAACCTAAGTTGGCAAACTCGAGTTTGCCAACTTAGGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-121s1c1
Sequence:CCGGCGCCGATCTATGCACGCAGATCTCGAGATCTGCGTGCATAGATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-1485s1c1
Sequence:CCGGCCCATATGTATGAACCGCATTCTCGAGAATGCGGTTCATACATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-685s1c1
Sequence:CCGGCCCATTCTTATTGAGGAATAACTCGAGTTATTCCTCAATAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144596
TTC8 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 8
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144596.2-2073s21c1
Sequence:CCGGGGTGGAGGTGGGAGGATTATACTCGAGTATAATCCTCCCACCTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-579s21c1
Sequence:CCGGAGTCCTGATGGACCATTTATACTCGAGTATAAATGGTCCATCAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144596.2-1730s21c1
Sequence:CCGGCCTGTCCTTGATATTAGTTAACTCGAGTTAACTAATATCAAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-976s21c1
Sequence:CCGGTCTATGAGGAAATGAACAATACTCGAGTATTGTTCATTTCCTCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-243s21c1
Sequence:CCGGGCGCTAACAGAAATGGTATACCTCGAGGTATACCATTTCTGTTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-1416s21c1
Sequence:CCGGGAACAGGCAAGGGCACTATTACTCGAGTAATAGTGCCCTTGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-1242s1c1
Sequence:CCGGCCTCATTTGAACGTGCCCTTTCTCGAGAAAGGGCACGTTCAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-580s1c1
Sequence:CCGGCCAGAAACCTAAGTTGGCAAACTCGAGTTTGCCAACTTAGGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-121s1c1
Sequence:CCGGCGCCGATCTATGCACGCAGATCTCGAGATCTGCGTGCATAGATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-1485s1c1
Sequence:CCGGCCCATATGTATGAACCGCATTCTCGAGAATGCGGTTCATACATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-685s1c1
Sequence:CCGGCCCATTCTTATTGAGGAATAACTCGAGTTATTCCTCAATAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144596
TTC8 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 8
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144596.2-2073s21c1
Sequence:CCGGGGTGGAGGTGGGAGGATTATACTCGAGTATAATCCTCCCACCTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-579s21c1
Sequence:CCGGAGTCCTGATGGACCATTTATACTCGAGTATAAATGGTCCATCAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144596.2-1730s21c1
Sequence:CCGGCCTGTCCTTGATATTAGTTAACTCGAGTTAACTAATATCAAGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-976s21c1
Sequence:CCGGTCTATGAGGAAATGAACAATACTCGAGTATTGTTCATTTCCTCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-243s21c1
Sequence:CCGGGCGCTAACAGAAATGGTATACCTCGAGGTATACCATTTCTGTTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144596.2-1416s21c1
Sequence:CCGGGAACAGGCAAGGGCACTATTACTCGAGTAATAGTGCCCTTGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-1242s1c1
Sequence:CCGGCCTCATTTGAACGTGCCCTTTCTCGAGAAAGGGCACGTTCAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-580s1c1
Sequence:CCGGCCAGAAACCTAAGTTGGCAAACTCGAGTTTGCCAACTTAGGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-121s1c1
Sequence:CCGGCGCCGATCTATGCACGCAGATCTCGAGATCTGCGTGCATAGATCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-1485s1c1
Sequence:CCGGCCCATATGTATGAACCGCATTCTCGAGAATGCGGTTCATACATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144596.1-685s1c1
Sequence:CCGGCCCATTCTTATTGAGGAATAACTCGAGTTATTCCTCAATAAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029553
TTC8 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-609s21c1
Sequence:CCGGCCAGAAGCCTAAGTTGGCAAACTCGAGTTTGCCAACTTAGGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-947s21c1
Sequence:CCGGCCAGGATCTATGAGGAAATGACTCGAGTCATTTCCTCATAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029553.2-1721s21c1
Sequence:CCGGCCGAACCTGTTGTCTGAACTTCTCGAGAAGTTCAGACAACAGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-274s21c1
Sequence:CCGGGCTGAAATGATCCTGGATGAACTCGAGTTCATCCAGGATCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-1545s21c1
Sequence:CCGGCGTGGACACACAGCACTTAATCTCGAGATTAAGTGCTGTGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029553.1-1722s1c1
Sequence:CCGGCCGAACCTGTTGTCTGAACTTCTCGAGAAGTTCAGACAACAGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-948s1c1
Sequence:CCGGCCAGGATCTATGAGGAAATGACTCGAGTCATTTCCTCATAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-610s1c1
Sequence:CCGGCCAGAAGCCTAAGTTGGCAAACTCGAGTTTGCCAACTTAGGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-1546s1c1
Sequence:CCGGCGTGGACACACAGCACTTAATCTCGAGATTAAGTGCTGTGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-275s1c1
Sequence:CCGGGCTGAAATGATCCTGGATGAACTCGAGTTCATCCAGGATCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029553
TTC8 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-609s21c1
Sequence:CCGGCCAGAAGCCTAAGTTGGCAAACTCGAGTTTGCCAACTTAGGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-947s21c1
Sequence:CCGGCCAGGATCTATGAGGAAATGACTCGAGTCATTTCCTCATAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029553.2-1721s21c1
Sequence:CCGGCCGAACCTGTTGTCTGAACTTCTCGAGAAGTTCAGACAACAGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-274s21c1
Sequence:CCGGGCTGAAATGATCCTGGATGAACTCGAGTTCATCCAGGATCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-1545s21c1
Sequence:CCGGCGTGGACACACAGCACTTAATCTCGAGATTAAGTGCTGTGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029553.1-1722s1c1
Sequence:CCGGCCGAACCTGTTGTCTGAACTTCTCGAGAAGTTCAGACAACAGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-948s1c1
Sequence:CCGGCCAGGATCTATGAGGAAATGACTCGAGTCATTTCCTCATAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-610s1c1
Sequence:CCGGCCAGAAGCCTAAGTTGGCAAACTCGAGTTTGCCAACTTAGGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-1546s1c1
Sequence:CCGGCGTGGACACACAGCACTTAATCTCGAGATTAAGTGCTGTGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-275s1c1
Sequence:CCGGGCTGAAATGATCCTGGATGAACTCGAGTTCATCCAGGATCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029553
TTC8 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-609s21c1
Sequence:CCGGCCAGAAGCCTAAGTTGGCAAACTCGAGTTTGCCAACTTAGGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-947s21c1
Sequence:CCGGCCAGGATCTATGAGGAAATGACTCGAGTCATTTCCTCATAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029553.2-1721s21c1
Sequence:CCGGCCGAACCTGTTGTCTGAACTTCTCGAGAAGTTCAGACAACAGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-274s21c1
Sequence:CCGGGCTGAAATGATCCTGGATGAACTCGAGTTCATCCAGGATCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029553.2-1545s21c1
Sequence:CCGGCGTGGACACACAGCACTTAATCTCGAGATTAAGTGCTGTGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029553.1-1722s1c1
Sequence:CCGGCCGAACCTGTTGTCTGAACTTCTCGAGAAGTTCAGACAACAGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-948s1c1
Sequence:CCGGCCAGGATCTATGAGGAAATGACTCGAGTCATTTCCTCATAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-610s1c1
Sequence:CCGGCCAGAAGCCTAAGTTGGCAAACTCGAGTTTGCCAACTTAGGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-1546s1c1
Sequence:CCGGCGTGGACACACAGCACTTAATCTCGAGATTAAGTGCTGTGTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029553.1-275s1c1
Sequence:CCGGGCTGAAATGATCCTGGATGAACTCGAGTTCATCCAGGATCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks