EMAIL THIS PAGE TO A FRIEND

TTC9

tetratricopeptide repeat domain 9

Synonyms: TTC9A
UniProtKB ID: Q92623, Q86WT2
Gene ID:
Human(23508) Summary: This gene encodes a protein that contains three tetratricopeptide repeats. The gene has been shown to be hormonally regulated in breast cancer cells and may play a role in cancer cell invasion and metastasis. [provided by RefSeq, Mar 2009]
Mouse(69480) tetratricopeptide repeat domain 9
Rat(500689) tetratricopeptide repeat domain 9
chicken(768624) tetratricopeptide repeat domain 9
domestic cat(101084459) tetratricopeptide repeat domain 9
dog(490764) tetratricopeptide repeat domain 9
domestic guinea pig(100715608) tetratricopeptide repeat domain 9
cow(523451) tetratricopeptide repeat domain 9
sheep(101102909) tetratricopeptide repeat domain 9
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015351 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015351 Rosetta Predictions human pricing
XM_027236 Rosetta Predictions human pricing
NM_001134731 Rosetta Predictions rat pricing
NM_001033149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347668 predicted 978
2 SASI_Hs02_00347669 predicted 784
3 SASI_Hs02_00347670 predicted 539
4 SASI_Hs02_00347671 predicted 698
5 SASI_Hs02_00347672 predicted 921
6 SASI_Hs02_00347673 predicted 927
7 SASI_Hs02_00347674 predicted 1253
8 SASI_Hs02_00347675 predicted 1306
9 SASI_Hs02_00347676 predicted 768
10 SASI_Hs02_00347677 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_027236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290317 predicted 1276
2 SASI_Hs01_00290318 predicted 1078
3 SASI_Hs01_00290319 predicted 1596
4 SASI_Hs01_00290320 predicted 841
5 SASI_Hs01_00290321 predicted 993
6 SASI_Hs01_00290322 predicted 1215
7 SASI_Hs01_00290323 predicted 1225
8 SASI_Hs01_00290324 predicted 1554
9 SASI_Hs01_00290325 predicted 1605
10 SASI_Hs01_00290326 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258224 predicted 1133
2 SASI_Rn02_00258225 predicted 934
3 SASI_Rn02_00258226 predicted 868
4 SASI_Rn02_00258227 predicted 444
5 SASI_Rn02_00258228 predicted 717
6 SASI_Rn02_00258229 predicted 836
7 SASI_Rn02_00258230 predicted 929
8 SASI_Rn02_00258231 predicted 932
9 SASI_Rn02_00258232 predicted 726
10 SASI_Rn02_00258233 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122945 predicted 1093
2 SASI_Mm01_00122946 predicted 394
3 SASI_Mm01_00122947 predicted 829
4 SASI_Mm01_00122948 predicted 1162
5 SASI_Mm01_00122949 predicted 385
6 SASI_Mm01_00122950 predicted 1097
7 SASI_Mm01_00122951 predicted 675
8 SASI_Mm01_00122952 predicted 1040
9 SASI_Mm01_00122953 predicted 614
10 SASI_Mm01_00122954 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033149
TTC9 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033149.2-1555s21c1
Sequence:CCGGCACTTAGACCAAGACTATATACTCGAGTATATAGTCTTGGTCTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-677s21c1
Sequence:CCGGGGGAGAAAGAAGCCATGTAACCTCGAGGTTACATGGCTTCTTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-510s21c1
Sequence:CCGGAGAGAACTTCAAAGCTCTTTACTCGAGTAAAGAGCTTTGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-445s21c1
Sequence:CCGGCAGGCCGAGCTGGTAAATTATCTCGAGATAATTTACCAGCTCGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-230s21c1
Sequence:CCGGAGTGCTACAAGGACAAGAAATCTCGAGATTTCTTGTCCTTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033149
TTC9 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033149.2-1555s21c1
Sequence:CCGGCACTTAGACCAAGACTATATACTCGAGTATATAGTCTTGGTCTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-677s21c1
Sequence:CCGGGGGAGAAAGAAGCCATGTAACCTCGAGGTTACATGGCTTCTTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-510s21c1
Sequence:CCGGAGAGAACTTCAAAGCTCTTTACTCGAGTAAAGAGCTTTGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-445s21c1
Sequence:CCGGCAGGCCGAGCTGGTAAATTATCTCGAGATAATTTACCAGCTCGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-230s21c1
Sequence:CCGGAGTGCTACAAGGACAAGAAATCTCGAGATTTCTTGTCCTTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033149
TTC9 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033149.2-1555s21c1
Sequence:CCGGCACTTAGACCAAGACTATATACTCGAGTATATAGTCTTGGTCTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-677s21c1
Sequence:CCGGGGGAGAAAGAAGCCATGTAACCTCGAGGTTACATGGCTTCTTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-510s21c1
Sequence:CCGGAGAGAACTTCAAAGCTCTTTACTCGAGTAAAGAGCTTTGAAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-445s21c1
Sequence:CCGGCAGGCCGAGCTGGTAAATTATCTCGAGATAATTTACCAGCTCGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033149.2-230s21c1
Sequence:CCGGAGTGCTACAAGGACAAGAAATCTCGAGATTTCTTGTCCTTGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015351
TTC9 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-935s21c1
Sequence:CCGGACCAACGTGATTCGGTATATCCTCGAGGATATACCGAATCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-781s21c1
Sequence:CCGGTGAACGAGTCAAGGAATATTGCTCGAGCAATATTCCTTGACTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015351.1-2406s21c1
Sequence:CCGGTACCAATGACACCGTTAATTTCTCGAGAAATTAACGGTGTCATTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-826s21c1
Sequence:CCGGGGAGAACTTCAAGGCCCTTTACTCGAGTAAAGGGCCTTGAAGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-561s21c1
Sequence:CCGGTCCGTGAAGCCATAGGCAAATCTCGAGATTTGCCTATGGCTTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015351
TTC9 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-935s21c1
Sequence:CCGGACCAACGTGATTCGGTATATCCTCGAGGATATACCGAATCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-781s21c1
Sequence:CCGGTGAACGAGTCAAGGAATATTGCTCGAGCAATATTCCTTGACTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015351.1-2406s21c1
Sequence:CCGGTACCAATGACACCGTTAATTTCTCGAGAAATTAACGGTGTCATTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-826s21c1
Sequence:CCGGGGAGAACTTCAAGGCCCTTTACTCGAGTAAAGGGCCTTGAAGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-561s21c1
Sequence:CCGGTCCGTGAAGCCATAGGCAAATCTCGAGATTTGCCTATGGCTTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015351
TTC9 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-935s21c1
Sequence:CCGGACCAACGTGATTCGGTATATCCTCGAGGATATACCGAATCACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-781s21c1
Sequence:CCGGTGAACGAGTCAAGGAATATTGCTCGAGCAATATTCCTTGACTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015351.1-2406s21c1
Sequence:CCGGTACCAATGACACCGTTAATTTCTCGAGAAATTAACGGTGTCATTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-826s21c1
Sequence:CCGGGGAGAACTTCAAGGCCCTTTACTCGAGTAAAGGGCCTTGAAGTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015351.1-561s21c1
Sequence:CCGGTCCGTGAAGCCATAGGCAAATCTCGAGATTTGCCTATGGCTTCACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks