EMAIL THIS PAGE TO A FRIEND

TTC9B

tetratricopeptide repeat domain 9B

UniProtKB ID: Q8N6N2, A8K0I5, Q96NP9
Gene ID:
Mouse(73032) tetratricopeptide repeat domain 9B
Rat(361528) tetratricopeptide repeat domain 9B
cow(100125944) tetratricopeptide repeat domain 9B
sheep(101118044) tetratricopeptide repeat domain 9B
domestic guinea pig(100716311) tetratricopeptide repeat domain 9B
naked mole-rat(101718824) tetratricopeptide repeat domain 9B
Zebrafish(559732) tetratricopeptide repeat domain 9B
domestic cat(101094556) tetratricopeptide repeat domain 9B
dog(484503) tetratricopeptide repeat domain 9B
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152479 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152479 Rosetta Predictions human pricing
NM_001108478 Rosetta Predictions rat pricing
NM_028417 Rosetta Predictions mouse pricing
XM_355870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176830 predicted 604
2 SASI_Hs01_00176831 predicted 604
3 SASI_Hs01_00176832 predicted 602
4 SASI_Hs01_00176834 predicted 225
5 SASI_Hs01_00176835 predicted 615
6 SASI_Hs01_00176836 predicted 524
7 SASI_Hs01_00176837 predicted 547
8 SASI_Hs01_00176838 predicted 618
9 SASI_Hs01_00176839 predicted 228
10 SASI_Hs02_00366254 predicted 471
11 SASI_Hs01_00176833 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239039 predicted 557
2 SASI_Rn02_00239040 predicted 559
3 SASI_Rn02_00239041 predicted 591
4 SASI_Rn02_00239042 predicted 593
5 SASI_Rn02_00239043 predicted 588
6 SASI_Rn02_00239044 predicted 585
7 SASI_Rn02_00239045 predicted 777
8 SASI_Rn02_00239046 predicted 603
9 SASI_Rn02_00239047 predicted 394
10 SASI_Rn02_00239048 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333817 predicted 602
2 SASI_Mm02_00333818 predicted 394
3 SASI_Mm02_00333819 predicted 534
4 SASI_Mm02_00333820 predicted 533
5 SASI_Mm02_00333821 predicted 219
6 SASI_Mm02_00333822 predicted 509
7 SASI_Mm02_00333823 predicted 488
8 SASI_Mm02_00333824 predicted 494
9 SASI_Mm02_00333825 predicted 602
10 SASI_Mm02_00333826 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247583 predicted 623
2 SASI_Mm01_00247584 predicted 409
3 SASI_Mm01_00247585 predicted 547
4 SASI_Mm01_00247586 predicted 551
5 SASI_Mm01_00247587 predicted 235
6 SASI_Mm01_00247588 predicted 528
7 SASI_Mm01_00247589 predicted 496
8 SASI_Mm01_00247590 predicted 517
9 SASI_Mm01_00247591 predicted 619
10 SASI_Mm01_00247592 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152479
TTC9B MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 9B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-456s21c1
Sequence:CCGGGCAGTCGGAGCTGGTAAACTACTCGAGTAGTTTACCAGCTCCGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-412s21c1
Sequence:CCGGAGCACGGAGGTGGAGTGTTACCTCGAGGTAACACTCCACCTCCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-523s21c1
Sequence:CCGAGGCAACTTCAAGGCCACCTACCTCGAGGTAGGTGGCCTTGAAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-618s21c1
Sequence:CCGGGGAACCCACAGACACCAATGTCTCGAGACATTGGTGTCTGTGGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-646s1c1
Sequence:CCGGGCTGACTCAGCTGAAGATGAACTCGAGTTCATCTTCAGCTGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-484s1c1
Sequence:CCGGGTACTGTCTCAAGGTACTGGACTCGAGTCCAGTACCTTGAGACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-658s1c1
Sequence:CCGGGAAGATGAATCGTTGCAGCCTCTCGAGAGGCTGCAACGATTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-231s1c1
Sequence:CCGGGCTGCTATCGAGAGAAGAAGTCTCGAGACTTCTTCTCTCGATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152479
TTC9B MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 9B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-456s21c1
Sequence:CCGGGCAGTCGGAGCTGGTAAACTACTCGAGTAGTTTACCAGCTCCGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-412s21c1
Sequence:CCGGAGCACGGAGGTGGAGTGTTACCTCGAGGTAACACTCCACCTCCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-523s21c1
Sequence:CCGAGGCAACTTCAAGGCCACCTACCTCGAGGTAGGTGGCCTTGAAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-618s21c1
Sequence:CCGGGGAACCCACAGACACCAATGTCTCGAGACATTGGTGTCTGTGGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-646s1c1
Sequence:CCGGGCTGACTCAGCTGAAGATGAACTCGAGTTCATCTTCAGCTGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-484s1c1
Sequence:CCGGGTACTGTCTCAAGGTACTGGACTCGAGTCCAGTACCTTGAGACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-658s1c1
Sequence:CCGGGAAGATGAATCGTTGCAGCCTCTCGAGAGGCTGCAACGATTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-231s1c1
Sequence:CCGGGCTGCTATCGAGAGAAGAAGTCTCGAGACTTCTTCTCTCGATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152479
TTC9B MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 9B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-456s21c1
Sequence:CCGGGCAGTCGGAGCTGGTAAACTACTCGAGTAGTTTACCAGCTCCGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-412s21c1
Sequence:CCGGAGCACGGAGGTGGAGTGTTACCTCGAGGTAACACTCCACCTCCGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-523s21c1
Sequence:CCGAGGCAACTTCAAGGCCACCTACCTCGAGGTAGGTGGCCTTGAAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152479.5-618s21c1
Sequence:CCGGGGAACCCACAGACACCAATGTCTCGAGACATTGGTGTCTGTGGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-646s1c1
Sequence:CCGGGCTGACTCAGCTGAAGATGAACTCGAGTTCATCTTCAGCTGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-484s1c1
Sequence:CCGGGTACTGTCTCAAGGTACTGGACTCGAGTCCAGTACCTTGAGACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-658s1c1
Sequence:CCGGGAAGATGAATCGTTGCAGCCTCTCGAGAGGCTGCAACGATTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152479.3-231s1c1
Sequence:CCGGGCTGCTATCGAGAGAAGAAGTCTCGAGACTTCTTCTCTCGATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028417
TTC9B MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 9B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-609s21c1
Sequence:CCGGCACCAATGTTCTCCGCTACATCTCGAGATGTAGCGGAGAACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-539s21c1
Sequence:CCGGTCTACCACTTGGGTGATTATGCTCGAGCATAATCACCCAAGTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-437s21c1
Sequence:CCGGAGTCGGAGCTGGTGAACTATGCTCGAGCATAGTTCACCAGCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028417.1-738s21c1
Sequence:CCGGCTCTACCTTAGTCCCTCCAACCTCGAGGTTGGAGGGACTAAGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-490s21c1
Sequence:CCGGGAGAAACAGCAGGGCAACTTCCTCGAGGAAGTTGCCCTGCTGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028417
TTC9B MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 9B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-609s21c1
Sequence:CCGGCACCAATGTTCTCCGCTACATCTCGAGATGTAGCGGAGAACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-539s21c1
Sequence:CCGGTCTACCACTTGGGTGATTATGCTCGAGCATAATCACCCAAGTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-437s21c1
Sequence:CCGGAGTCGGAGCTGGTGAACTATGCTCGAGCATAGTTCACCAGCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028417.1-738s21c1
Sequence:CCGGCTCTACCTTAGTCCCTCCAACCTCGAGGTTGGAGGGACTAAGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-490s21c1
Sequence:CCGGGAGAAACAGCAGGGCAACTTCCTCGAGGAAGTTGCCCTGCTGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028417
TTC9B MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 9B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-609s21c1
Sequence:CCGGCACCAATGTTCTCCGCTACATCTCGAGATGTAGCGGAGAACATTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-539s21c1
Sequence:CCGGTCTACCACTTGGGTGATTATGCTCGAGCATAATCACCCAAGTGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-437s21c1
Sequence:CCGGAGTCGGAGCTGGTGAACTATGCTCGAGCATAGTTCACCAGCTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028417.1-738s21c1
Sequence:CCGGCTCTACCTTAGTCCCTCCAACCTCGAGGTTGGAGGGACTAAGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028417.1-490s21c1
Sequence:CCGGGAGAAACAGCAGGGCAACTTCCTCGAGGAAGTTGCCCTGCTGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks