EMAIL THIS PAGE TO A FRIEND

TTC9C

tetratricopeptide repeat domain 9C

UniProtKB ID: Q8N5M4
Gene ID:
Mouse(70387) tetratricopeptide repeat domain 9C
Rat(309196) tetratricopeptide repeat domain 9C
Zebrafish(393235) tetratricopeptide repeat domain 9C
domestic cat(101091811) tetratricopeptide repeat domain 9C
dog(483782) tetratricopeptide repeat domain 9C
naked mole-rat(101696533) tetratricopeptide repeat domain 9C
domestic guinea pig(100729164) tetratricopeptide repeat domain 9C
cow(786577) tetratricopeptide repeat domain 9C
Goat(100860968) tetratricopeptide repeat domain 9C
sheep(101114568) tetratricopeptide repeat domain 9C
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173810 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122961 MISSION® esiRNA esiRNA human TTC9C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173810 Rosetta Predictions human pricing
NM_001007693 Rosetta Predictions rat pricing
NM_027412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190887 predicted 639
2 SASI_Hs01_00190888 predicted 904
3 SASI_Hs01_00190889 predicted 665
4 SASI_Hs01_00190890 predicted 665
5 SASI_Hs01_00190891 predicted 620
6 SASI_Hs01_00190892 predicted 497
7 SASI_Hs01_00190893 predicted 858
8 SASI_Hs01_00190894 predicted 639
9 SASI_Hs01_00190895 predicted 627
10 SASI_Hs02_00368668 predicted 638
11 SASI_Hs01_00190886 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115832 predicted 1042
2 SASI_Rn01_00115833 predicted 648
3 SASI_Rn01_00115836 predicted 1000
4 SASI_Rn01_00115838 predicted 706
5 SASI_Rn02_00198847 predicted 576
6 SASI_Rn01_00115839 predicted 1032
7 SASI_Rn01_00115840 predicted 925
8 SASI_Rn01_00115841 predicted 507
9 SASI_Rn02_00198848 predicted 514
10 SASI_Rn02_00198849 predicted 907
11 SASI_Rn01_00115834 predicted 791
12 SASI_Rn01_00115835 predicted 843
13 SASI_Rn01_00115837 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332149 predicted 560
2 SASI_Mm01_00155887 predicted 893
3 SASI_Mm02_00332150 predicted 489
4 SASI_Mm01_00155888 predicted 695
5 SASI_Mm01_00155890 predicted 815
6 SASI_Mm02_00332151 predicted 532
7 SASI_Mm02_00332152 predicted 804
8 SASI_Mm02_00332153 predicted 295
9 SASI_Mm01_00155894 predicted 555
10 SASI_Mm01_00155891 predicted 765
11 SASI_Mm01_00155886 predicted 919
12 SASI_Mm01_00155889 predicted 861
13 SASI_Mm01_00155892 predicted 1115
14 SASI_Mm01_00155893 predicted 1074
15 SASI_Mm01_00155895 predicted 909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173810
VALIDATED
TTC9C MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 9C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-670s1c1
Sequence:CCGGCTGGAACGACAGCCTGATAATCTCGAGATTATCAGGCTGTCGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173810.3-944s1c1
Sequence:CCGGGAGAAATCTGAGCCTCAGCAACTCGAGTTGCTGAGGCTCAGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-445s1c1
Sequence:CCGGGATGCTGTGAGTAGGTACCATCTCGAGATGGTACCTACTCACAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173810.3-953s1c1
Sequence:CCGGGAGCCTCAGCAAGAGAAATTACTCGAGTAATTTCTCTTGCTGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-646s1c1
Sequence:CCGGGTGAGAGAATATAGTCAGAAACTCGAGTTTCTGACTATATTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173810.3-925s1c1
Sequence:CCGGCCATTAAACATGCATGAAGGACTCGAGTCCTTCATGCATGTTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-685s1c1
Sequence:CCGGGATAATGCCAAGGCCTTGTATCTCGAGATACAAGGCCTTGGCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173810.3-829s21c1
Sequence:CCGGGAACTCAGCAGCTACCATAGACTCGAGTCTATGGTAGCTGCTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173810.3-686s21c1
Sequence:CCGGATAATGCCAAGGCCTTGTATCCTCGAGGATACAAGGCCTTGGCATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173810.3-542s21c1
Sequence:CCGGCCCTCACGCCTGAACAAGAAACTCGAGTTTCTTGTTCAGGCGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173810
VALIDATED
TTC9C MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 9C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-670s1c1
Sequence:CCGGCTGGAACGACAGCCTGATAATCTCGAGATTATCAGGCTGTCGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173810.3-944s1c1
Sequence:CCGGGAGAAATCTGAGCCTCAGCAACTCGAGTTGCTGAGGCTCAGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-445s1c1
Sequence:CCGGGATGCTGTGAGTAGGTACCATCTCGAGATGGTACCTACTCACAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173810.3-953s1c1
Sequence:CCGGGAGCCTCAGCAAGAGAAATTACTCGAGTAATTTCTCTTGCTGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-646s1c1
Sequence:CCGGGTGAGAGAATATAGTCAGAAACTCGAGTTTCTGACTATATTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173810.3-925s1c1
Sequence:CCGGCCATTAAACATGCATGAAGGACTCGAGTCCTTCATGCATGTTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-685s1c1
Sequence:CCGGGATAATGCCAAGGCCTTGTATCTCGAGATACAAGGCCTTGGCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173810.3-829s21c1
Sequence:CCGGGAACTCAGCAGCTACCATAGACTCGAGTCTATGGTAGCTGCTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173810.3-686s21c1
Sequence:CCGGATAATGCCAAGGCCTTGTATCCTCGAGGATACAAGGCCTTGGCATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173810.3-542s21c1
Sequence:CCGGCCCTCACGCCTGAACAAGAAACTCGAGTTTCTTGTTCAGGCGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173810
VALIDATED
TTC9C MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 9C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-670s1c1
Sequence:CCGGCTGGAACGACAGCCTGATAATCTCGAGATTATCAGGCTGTCGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173810.3-944s1c1
Sequence:CCGGGAGAAATCTGAGCCTCAGCAACTCGAGTTGCTGAGGCTCAGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-445s1c1
Sequence:CCGGGATGCTGTGAGTAGGTACCATCTCGAGATGGTACCTACTCACAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173810.3-953s1c1
Sequence:CCGGGAGCCTCAGCAAGAGAAATTACTCGAGTAATTTCTCTTGCTGAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-646s1c1
Sequence:CCGGGTGAGAGAATATAGTCAGAAACTCGAGTTTCTGACTATATTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_173810.3-925s1c1
Sequence:CCGGCCATTAAACATGCATGAAGGACTCGAGTCCTTCATGCATGTTTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173810.3-685s1c1
Sequence:CCGGGATAATGCCAAGGCCTTGTATCTCGAGATACAAGGCCTTGGCATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173810.3-829s21c1
Sequence:CCGGGAACTCAGCAGCTACCATAGACTCGAGTCTATGGTAGCTGCTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173810.3-686s21c1
Sequence:CCGGATAATGCCAAGGCCTTGTATCCTCGAGGATACAAGGCCTTGGCATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173810.3-542s21c1
Sequence:CCGGCCCTCACGCCTGAACAAGAAACTCGAGTTTCTTGTTCAGGCGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027412
VALIDATED
TTC9C MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat domain 9C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027412.1-1269s1c1
Sequence:CCGGGCACAAGTTCTTTGCTCCTTACTCGAGTAAGGAGCAAAGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027412.1-1028s1c1
Sequence:CCGGCAACCTAAAGATGCCAATGTTCTCGAGAACATTGGCATCTTTAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027412.1-917s1c1
Sequence:CCGGCTAGAACGACAACCCGATAATCTCGAGATTATCGGGTTGTCGTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027412.1-674s1c1
Sequence:CCGGCGGGAAGGAAAGTACCGAGATCTCGAGATCTCGGTACTTTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027412.1-1084s1c1
Sequence:CCGGCAGCTACCATAGGAAGGAGAACTCGAGTTCTCCTTCCTATGGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-458s21c1
Sequence:CCGGCTCTCACACCGGAGCAAGAAACTCGAGTTTCTTGCTCCGGTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-787s21c1
Sequence:CCGGGGCATGTTTGGTTAATGAAGACTCGAGTCTTCATTAACCAAACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-563s21c1
Sequence:CCGGTGAGGGAATACAGTCAGAAAGCTCGAGCTTTCTGACTGTATTCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027412.3-958s21c1
Sequence:CCGGAGACCATCTGCATCGTTTATTCTCGAGAATAAACGATGCAGATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-732s21c1
Sequence:CCGGGTTGACGCAGTCAGAACTCAGCTCGAGCTGAGTTCTGACTGCGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027412
VALIDATED
TTC9C MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat domain 9C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027412.1-1269s1c1
Sequence:CCGGGCACAAGTTCTTTGCTCCTTACTCGAGTAAGGAGCAAAGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027412.1-1028s1c1
Sequence:CCGGCAACCTAAAGATGCCAATGTTCTCGAGAACATTGGCATCTTTAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027412.1-917s1c1
Sequence:CCGGCTAGAACGACAACCCGATAATCTCGAGATTATCGGGTTGTCGTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027412.1-674s1c1
Sequence:CCGGCGGGAAGGAAAGTACCGAGATCTCGAGATCTCGGTACTTTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027412.1-1084s1c1
Sequence:CCGGCAGCTACCATAGGAAGGAGAACTCGAGTTCTCCTTCCTATGGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-458s21c1
Sequence:CCGGCTCTCACACCGGAGCAAGAAACTCGAGTTTCTTGCTCCGGTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-787s21c1
Sequence:CCGGGGCATGTTTGGTTAATGAAGACTCGAGTCTTCATTAACCAAACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-563s21c1
Sequence:CCGGTGAGGGAATACAGTCAGAAAGCTCGAGCTTTCTGACTGTATTCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027412.3-958s21c1
Sequence:CCGGAGACCATCTGCATCGTTTATTCTCGAGAATAAACGATGCAGATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-732s21c1
Sequence:CCGGGTTGACGCAGTCAGAACTCAGCTCGAGCTGAGTTCTGACTGCGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027412
VALIDATED
TTC9C MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat domain 9C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027412.1-1269s1c1
Sequence:CCGGGCACAAGTTCTTTGCTCCTTACTCGAGTAAGGAGCAAAGAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027412.1-1028s1c1
Sequence:CCGGCAACCTAAAGATGCCAATGTTCTCGAGAACATTGGCATCTTTAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027412.1-917s1c1
Sequence:CCGGCTAGAACGACAACCCGATAATCTCGAGATTATCGGGTTGTCGTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027412.1-674s1c1
Sequence:CCGGCGGGAAGGAAAGTACCGAGATCTCGAGATCTCGGTACTTTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027412.1-1084s1c1
Sequence:CCGGCAGCTACCATAGGAAGGAGAACTCGAGTTCTCCTTCCTATGGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-458s21c1
Sequence:CCGGCTCTCACACCGGAGCAAGAAACTCGAGTTTCTTGCTCCGGTGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-787s21c1
Sequence:CCGGGGCATGTTTGGTTAATGAAGACTCGAGTCTTCATTAACCAAACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-563s21c1
Sequence:CCGGTGAGGGAATACAGTCAGAAAGCTCGAGCTTTCTGACTGTATTCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027412.3-958s21c1
Sequence:CCGGAGACCATCTGCATCGTTTATTCTCGAGAATAAACGATGCAGATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027412.3-732s21c1
Sequence:CCGGGTTGACGCAGTCAGAACTCAGCTCGAGCTGAGTTCTGACTGCGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks