EMAIL THIS PAGE TO A FRIEND

TTF1

transcription termination factor, RNA polymerase I

Synonyms: TTF-1 TTF-I
UniProtKB ID: Q15361, A1L160, Q4VXF3, Q58EY2, Q6P5T5
Gene ID:
Human(7270) Summary: This gene encodes a transcription termination factor that is localized to the nucleolus and plays a critical role in ribosomal gene transcription. The encoded protein mediates the termination of RNA polymerase I transcription by binding to Sal box terminator elements downstream of pre-rRNA coding regions. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene shares the symbol/alias 'TFF1' with another gene, NK2 homeobox 1, also known as thyroid transcription factor 1, which plays a role in the regulation of thyroid-specific gene expression. [provided by RefSeq, Apr 2011]
Mouse(22130) transcription termination factor, RNA polymerase I
Rat(499766) transcription termination factor, RNA polymerase I
Zebrafish(334973) transcription termination factor, RNA polymerase I
dog(608462) transcription termination factor, RNA polymerase I
domestic cat(101100257) transcription termination factor, RNA polymerase I
chicken(417169) transcription termination factor, RNA polymerase I
cow(524585) transcription termination factor, RNA polymerase I
sheep(101120403) transcription termination factor, RNA polymerase I
domestic guinea pig(100726841) transcription termination factor, RNA polymerase I
naked mole-rat(101711785) transcription termination factor, RNA polymerase I
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007344 Rosetta Predictions human pricing
XM_001079280 Rosetta Predictions rat pricing
XM_575102 Rosetta Predictions rat pricing
NM_009442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120786 predicted 2162
2 SASI_Hs01_00120787 predicted 2420
3 SASI_Hs02_00343430 predicted 1935
4 SASI_Hs01_00120788 predicted 2347
5 SASI_Hs01_00120789 predicted 2294
6 SASI_Hs02_00343431 predicted 482
7 SASI_Hs01_00120790 predicted 1499
8 SASI_Hs01_00120791 predicted 474
9 SASI_Hs01_00120792 predicted 1869
10 SASI_Hs01_00120794 predicted 2192
11 SASI_Hs01_00120793 predicted 416
12 SASI_Hs01_00120795 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363782 predicted 506
2 SASI_Rn02_00363783 predicted 1261
3 SASI_Rn02_00363784 predicted 1713
4 SASI_Rn02_00363785 predicted 469
5 SASI_Rn02_00363786 predicted 1220
6 SASI_Rn02_00363787 predicted 1982
7 SASI_Rn02_00363788 predicted 2154
8 SASI_Rn02_00363789 predicted 1806
9 SASI_Rn02_00363790 predicted 2137
10 SASI_Rn02_00363791 predicted 1651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403055 predicted 2256
2 SASI_Rn02_00403056 predicted 1564
3 SASI_Rn02_00403057 predicted 1594
4 SASI_Rn02_00403058 predicted 1566
5 SASI_Rn02_00403059 predicted 1583
6 SASI_Rn02_00403060 predicted 1544
7 SASI_Rn02_00403061 predicted 1581
8 SASI_Rn02_00403062 predicted 1605
9 SASI_Rn02_00403063 predicted 1570
10 SASI_Rn02_00403064 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057661 predicted 2270
2 SASI_Mm01_00057662 predicted 2241
3 SASI_Mm01_00057663 predicted 1557
4 SASI_Mm01_00057664 predicted 1563
5 SASI_Mm01_00057665 predicted 542
6 SASI_Mm01_00057666 predicted 1324
7 SASI_Mm02_00316143 predicted 2440
8 SASI_Mm01_00057667 predicted 2260
9 SASI_Mm01_00057668 predicted 1935
10 SASI_Mm01_00057669 predicted 2268
11 SASI_Mm01_00057670 predicted 2026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007344
VALIDATED
TTF1 MISSION shRNA Bacterial Glycerol Stock
transcription termination factor, RNA polymerase I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-2513s21c1
Sequence:CCGGCCAGAGATCATCGACTACCTTCTCGAGAAGGTAGTCGATGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-1414s21c1
Sequence:CCGGGCCAAGGTTAGAACCTGCAAACTCGAGTTTGCAGGTTCTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-1637s21c1
Sequence:CCGGGCACAAGGTGTCGCTATTAAACTCGAGTTTAATAGCGACACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007344.2-726s21c1
Sequence:CCGGAGTCCAGTAACCGGGAATATGCTCGAGCATATTCCCGGTTACTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-2804s21c1
Sequence:CCGGGTGAAGACCTGTCACTATTAACTCGAGTTAATAGTGACAGGTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007344.2-137s1c1
Sequence:CCGGCCTCAGAAACATTCCCACGAACTCGAGTTCGTGGGAATGTTTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007344.2-1414s1c1
Sequence:CCGGGCCAAGGTTAGAACCTGCAAACTCGAGTTTGCAGGTTCTAACCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007344.2-1847s1c1
Sequence:CCGGCCCTGGAAACTTATATACTATCTCGAGATAGTATATAAGTTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007344.2-2513s1c1
Sequence:CCGGCCAGAGATCATCGACTACCTTCTCGAGAAGGTAGTCGATGATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007344
VALIDATED
TTF1 MISSION shRNA shRNA Plasmid DNA
transcription termination factor, RNA polymerase I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-2513s21c1
Sequence:CCGGCCAGAGATCATCGACTACCTTCTCGAGAAGGTAGTCGATGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-1414s21c1
Sequence:CCGGGCCAAGGTTAGAACCTGCAAACTCGAGTTTGCAGGTTCTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-1637s21c1
Sequence:CCGGGCACAAGGTGTCGCTATTAAACTCGAGTTTAATAGCGACACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007344.2-726s21c1
Sequence:CCGGAGTCCAGTAACCGGGAATATGCTCGAGCATATTCCCGGTTACTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-2804s21c1
Sequence:CCGGGTGAAGACCTGTCACTATTAACTCGAGTTAATAGTGACAGGTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007344.2-137s1c1
Sequence:CCGGCCTCAGAAACATTCCCACGAACTCGAGTTCGTGGGAATGTTTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007344.2-1414s1c1
Sequence:CCGGGCCAAGGTTAGAACCTGCAAACTCGAGTTTGCAGGTTCTAACCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007344.2-1847s1c1
Sequence:CCGGCCCTGGAAACTTATATACTATCTCGAGATAGTATATAAGTTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007344.2-2513s1c1
Sequence:CCGGCCAGAGATCATCGACTACCTTCTCGAGAAGGTAGTCGATGATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007344
VALIDATED
TTF1 MISSION shRNA Lentiviral Transduction Particles
transcription termination factor, RNA polymerase I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-2513s21c1
Sequence:CCGGCCAGAGATCATCGACTACCTTCTCGAGAAGGTAGTCGATGATCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-1414s21c1
Sequence:CCGGGCCAAGGTTAGAACCTGCAAACTCGAGTTTGCAGGTTCTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-1637s21c1
Sequence:CCGGGCACAAGGTGTCGCTATTAAACTCGAGTTTAATAGCGACACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007344.2-726s21c1
Sequence:CCGGAGTCCAGTAACCGGGAATATGCTCGAGCATATTCCCGGTTACTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007344.2-2804s21c1
Sequence:CCGGGTGAAGACCTGTCACTATTAACTCGAGTTAATAGTGACAGGTCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007344.2-137s1c1
Sequence:CCGGCCTCAGAAACATTCCCACGAACTCGAGTTCGTGGGAATGTTTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007344.2-1414s1c1
Sequence:CCGGGCCAAGGTTAGAACCTGCAAACTCGAGTTTGCAGGTTCTAACCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007344.2-1847s1c1
Sequence:CCGGCCCTGGAAACTTATATACTATCTCGAGATAGTATATAAGTTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007344.2-2513s1c1
Sequence:CCGGCCAGAGATCATCGACTACCTTCTCGAGAAGGTAGTCGATGATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009442
VALIDATED
TTF1 MISSION shRNA Bacterial Glycerol Stock
transcription termination factor, RNA polymerase I
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-628s21c1
Sequence:GTACCGGGGGATCATCCTTGTAGATAAACTCGAGTTTATCTACAAGGATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009442.2-3307s21c1
Sequence:CCGGGCTAATGAAACCGCCCATATACTCGAGTATATGGGCGGTTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-1361s21c1
Sequence:CCGGATTCGGAATCAGCTAGCAATTCTCGAGAATTGCTAGCTGATTCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-2267s21c1
Sequence:CCGGCCCTTATTGAAAGGTTGTATGCTCGAGCATACAACCTTTCAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-1551s21c1
Sequence:CCGGGGCACAAGGTGTGGCTATTAGCTCGAGCTAATAGCCACACCTTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009442.1-3304s1c1
Sequence:CCGGGCACTATTAGAAGGTGGACTACTCGAGTAGTCCACCTTCTAATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009442.1-1728s1c1
Sequence:CCGGGCAGGTACAATGAAGAAGATACTCGAGTATCTTCTTCATTGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009442.1-1370s1c1
Sequence:CCGGCGAGAGTTCATTCCTGACATACTCGAGTATGTCAGGAATGAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009442.1-1008s1c1
Sequence:CCGGGCACCAAAGAATCCCACAGTACTCGAGTACTGTGGGATTCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009442.1-1251s1c1
Sequence:CCGGCCCATGAAGAAGAAAGCAATTCTCGAGAATTGCTTTCTTCTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009442
VALIDATED
TTF1 MISSION shRNA shRNA Plasmid DNA
transcription termination factor, RNA polymerase I
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-628s21c1
Sequence:GTACCGGGGGATCATCCTTGTAGATAAACTCGAGTTTATCTACAAGGATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009442.2-3307s21c1
Sequence:CCGGGCTAATGAAACCGCCCATATACTCGAGTATATGGGCGGTTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-1361s21c1
Sequence:CCGGATTCGGAATCAGCTAGCAATTCTCGAGAATTGCTAGCTGATTCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-2267s21c1
Sequence:CCGGCCCTTATTGAAAGGTTGTATGCTCGAGCATACAACCTTTCAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-1551s21c1
Sequence:CCGGGGCACAAGGTGTGGCTATTAGCTCGAGCTAATAGCCACACCTTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009442.1-3304s1c1
Sequence:CCGGGCACTATTAGAAGGTGGACTACTCGAGTAGTCCACCTTCTAATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009442.1-1728s1c1
Sequence:CCGGGCAGGTACAATGAAGAAGATACTCGAGTATCTTCTTCATTGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009442.1-1370s1c1
Sequence:CCGGCGAGAGTTCATTCCTGACATACTCGAGTATGTCAGGAATGAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009442.1-1008s1c1
Sequence:CCGGGCACCAAAGAATCCCACAGTACTCGAGTACTGTGGGATTCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009442.1-1251s1c1
Sequence:CCGGCCCATGAAGAAGAAAGCAATTCTCGAGAATTGCTTTCTTCTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009442
VALIDATED
TTF1 MISSION shRNA Lentiviral Transduction Particles
transcription termination factor, RNA polymerase I
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-628s21c1
Sequence:GTACCGGGGGATCATCCTTGTAGATAAACTCGAGTTTATCTACAAGGATGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009442.2-3307s21c1
Sequence:CCGGGCTAATGAAACCGCCCATATACTCGAGTATATGGGCGGTTTCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-1361s21c1
Sequence:CCGGATTCGGAATCAGCTAGCAATTCTCGAGAATTGCTAGCTGATTCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-2267s21c1
Sequence:CCGGCCCTTATTGAAAGGTTGTATGCTCGAGCATACAACCTTTCAATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009442.2-1551s21c1
Sequence:CCGGGGCACAAGGTGTGGCTATTAGCTCGAGCTAATAGCCACACCTTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009442.1-3304s1c1
Sequence:CCGGGCACTATTAGAAGGTGGACTACTCGAGTAGTCCACCTTCTAATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009442.1-1728s1c1
Sequence:CCGGGCAGGTACAATGAAGAAGATACTCGAGTATCTTCTTCATTGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009442.1-1370s1c1
Sequence:CCGGCGAGAGTTCATTCCTGACATACTCGAGTATGTCAGGAATGAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009442.1-1008s1c1
Sequence:CCGGGCACCAAAGAATCCCACAGTACTCGAGTACTGTGGGATTCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009442.1-1251s1c1
Sequence:CCGGCCCATGAAGAAGAAAGCAATTCTCGAGAATTGCTTTCTTCTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks