EMAIL THIS PAGE TO A FRIEND

TTF2

transcription termination factor, RNA polymerase II

Synonyms: HuF2
UniProtKB ID: Q9UNY4, A8K4Q2, O75921, Q5T2K7, Q5VVU8, Q8N6I8
Gene ID:
Human(8458) Summary: This gene encodes a member of the SWI2/SNF2 family of proteins, which play a critical role in altering protein-DNA interactions. The encoded protein has been shown to have dsDNA-dependent ATPase activity and RNA polymerase II termination activity. This protein interacts with cell division cycle 5-like, associates with human splicing complexes, and plays a role in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Mouse(74044) transcription termination factor, RNA polymerase II
Rat(295324) transcription termination factor, RNA polymerase II
naked mole-rat(101699476) transcription termination factor, RNA polymerase II
Domestic Rabbit(100340161) transcription termination factor, RNA polymerase II
domestic guinea pig(100723600) transcription termination factor, RNA polymerase II
cow(531369) transcription termination factor, RNA polymerase II
sheep(101107238) transcription termination factor, RNA polymerase II
chicken(418376) transcription termination factor, RNA polymerase II
domestic cat(101086078) transcription termination factor, RNA polymerase II
Horse(100059720) transcription termination factor, RNA polymerase II
dog(100684320) transcription termination factor, RNA polymerase II
Gene Class: ATPase
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_207781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_207781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_207781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003594 Rosetta Predictions human pricing
NM_001106454 Rosetta Predictions rat pricing
NM_001013026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028487 predicted 725
2 SASI_Hs01_00028488 predicted 695
3 SASI_Hs01_00028489 predicted 2495
4 SASI_Hs01_00028490 predicted 2880
5 SASI_Hs01_00028491 predicted 3298
6 SASI_Hs01_00028492 predicted 2662
7 SASI_Hs01_00028493 predicted 2181
8 SASI_Hs01_00028494 predicted 1163
9 SASI_Hs01_00028495 predicted 1635
10 SASI_Hs02_00335925 predicted 2212
11 SASI_Hs01_00028496 predicted 2385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219118 predicted 235
2 SASI_Rn02_00219119 predicted 89
3 SASI_Rn02_00219120 predicted 152
4 SASI_Rn02_00219121 predicted 142
5 SASI_Rn02_00219122 predicted 184
6 SASI_Rn02_00219123 predicted 155
7 SASI_Rn02_00219124 predicted 111
8 SASI_Rn02_00219125 predicted 157
9 SASI_Rn02_00219126 predicted 194
10 SASI_Rn02_00219127 predicted 101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052007 predicted 3462
2 SASI_Mm01_00052009 predicted 3252
3 SASI_Mm01_00052010 predicted 2309
4 SASI_Mm01_00052011 predicted 2009
5 SASI_Mm01_00052012 predicted 2868
6 SASI_Mm01_00052013 predicted 2505
7 SASI_Mm01_00052014 predicted 3262
8 SASI_Mm01_00052015 predicted 490
9 SASI_Mm01_00052016 predicted 2591
10 SASI_Mm02_00287150 predicted 396
11 SASI_Mm01_00052008 predicted 528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003594
TTF2 MISSION shRNA Bacterial Glycerol Stock
transcription termination factor, RNA polymerase II
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-2668s1c1
Sequence:CCGGGCCCTAATAATCCATTCAGTACTCGAGTACTGAATGGATTATTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-86s1c1
Sequence:CCGGCCCGAATAAAGGAAAGAGCTTCTCGAGAAGCTCTTTCCTTTATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-1829s1c1
Sequence:CCGGCCTGACAATGATTGCGCTCATCTCGAGATGAGCGCAATCATTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-1260s1c1
Sequence:CCGGCGTGTCTACCTTACAACACAACTCGAGTTGTGTTGTAAGGTAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-2214s1c1
Sequence:CCGGGCTCGAATCATATTGGATGAACTCGAGTTCATCCAATATGATTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003594.3-1967s21c1
Sequence:CCGGTGCCTCCCTGATCCATCATTGCTCGAGCAATGATGGATCAGGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003594.3-3308s21c1
Sequence:CCGGTCAAGCTTGTGACCGAATTTACTCGAGTAAATTCGGTCACAAGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003594
TTF2 MISSION shRNA shRNA Plasmid DNA
transcription termination factor, RNA polymerase II
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-2668s1c1
Sequence:CCGGGCCCTAATAATCCATTCAGTACTCGAGTACTGAATGGATTATTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-86s1c1
Sequence:CCGGCCCGAATAAAGGAAAGAGCTTCTCGAGAAGCTCTTTCCTTTATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-1829s1c1
Sequence:CCGGCCTGACAATGATTGCGCTCATCTCGAGATGAGCGCAATCATTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-1260s1c1
Sequence:CCGGCGTGTCTACCTTACAACACAACTCGAGTTGTGTTGTAAGGTAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-2214s1c1
Sequence:CCGGGCTCGAATCATATTGGATGAACTCGAGTTCATCCAATATGATTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003594.3-1967s21c1
Sequence:CCGGTGCCTCCCTGATCCATCATTGCTCGAGCAATGATGGATCAGGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003594.3-3308s21c1
Sequence:CCGGTCAAGCTTGTGACCGAATTTACTCGAGTAAATTCGGTCACAAGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003594
TTF2 MISSION shRNA Lentiviral Transduction Particles
transcription termination factor, RNA polymerase II
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-2668s1c1
Sequence:CCGGGCCCTAATAATCCATTCAGTACTCGAGTACTGAATGGATTATTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-86s1c1
Sequence:CCGGCCCGAATAAAGGAAAGAGCTTCTCGAGAAGCTCTTTCCTTTATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-1829s1c1
Sequence:CCGGCCTGACAATGATTGCGCTCATCTCGAGATGAGCGCAATCATTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-1260s1c1
Sequence:CCGGCGTGTCTACCTTACAACACAACTCGAGTTGTGTTGTAAGGTAGACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003594.3-2214s1c1
Sequence:CCGGGCTCGAATCATATTGGATGAACTCGAGTTCATCCAATATGATTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003594.3-1967s21c1
Sequence:CCGGTGCCTCCCTGATCCATCATTGCTCGAGCAATGATGGATCAGGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003594.3-3308s21c1
Sequence:CCGGTCAAGCTTGTGACCGAATTTACTCGAGTAAATTCGGTCACAAGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_207781
VALIDATED
TTF2 MISSION shRNA Bacterial Glycerol Stock
transcription termination factor, RNA polymerase II
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_207781.3-3593s1c1
Sequence:CCGGCCCATTGGTTATTTCAGAATTCTCGAGAATTCTGAAATAACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-467s1c1
Sequence:CCGGGCTGATAAGAAGCTGAGAGAACTCGAGTTCTCTCAGCTTCTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-2546s1c1
Sequence:CCGGCAGTCCTATCTAAAGAGACAACTCGAGTTGTCTCTTTAGATAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-2595s1c1
Sequence:CCGGGCCCTGATAATCCATTCAGTACTCGAGTACTGAATGGATTATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-2180s1c1
Sequence:CCGGCCTCGAGTACAGACATCCATTCTCGAGAATGGATGTCTGTACTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_207781
VALIDATED
TTF2 MISSION shRNA shRNA Plasmid DNA
transcription termination factor, RNA polymerase II
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_207781.3-3593s1c1
Sequence:CCGGCCCATTGGTTATTTCAGAATTCTCGAGAATTCTGAAATAACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-467s1c1
Sequence:CCGGGCTGATAAGAAGCTGAGAGAACTCGAGTTCTCTCAGCTTCTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-2546s1c1
Sequence:CCGGCAGTCCTATCTAAAGAGACAACTCGAGTTGTCTCTTTAGATAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-2595s1c1
Sequence:CCGGGCCCTGATAATCCATTCAGTACTCGAGTACTGAATGGATTATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-2180s1c1
Sequence:CCGGCCTCGAGTACAGACATCCATTCTCGAGAATGGATGTCTGTACTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_207781
VALIDATED
TTF2 MISSION shRNA Lentiviral Transduction Particles
transcription termination factor, RNA polymerase II
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_207781.3-3593s1c1
Sequence:CCGGCCCATTGGTTATTTCAGAATTCTCGAGAATTCTGAAATAACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-467s1c1
Sequence:CCGGGCTGATAAGAAGCTGAGAGAACTCGAGTTCTCTCAGCTTCTTATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-2546s1c1
Sequence:CCGGCAGTCCTATCTAAAGAGACAACTCGAGTTGTCTCTTTAGATAGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-2595s1c1
Sequence:CCGGGCCCTGATAATCCATTCAGTACTCGAGTACTGAATGGATTATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207781.3-2180s1c1
Sequence:CCGGCCTCGAGTACAGACATCCATTCTCGAGAATGGATGTCTGTACTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks