EMAIL THIS PAGE TO A FRIEND

TTI1

TELO2 interacting protein 1

Synonyms: KIAA0406 smg-10
UniProtKB ID: O43156, Q5JX67, Q96A38, Q9BR47, Q9H4K0
Gene ID:
Mouse(75425) TELO2 interacting protein 1
Rat(499935) TELO2 interacting protein 1
cow(534917) TELO2 interacting protein 1
sheep(101103830) TELO2 interacting protein 1
domestic guinea pig(100730540) TELO2 interacting protein 1
naked mole-rat(101700539) TELO2 interacting protein 1
Zebrafish(570077) TELO2 interacting protein 1
chicken(419296) TELO2 interacting protein 1
dog(477225) TELO2 interacting protein 1
domestic cat(101099197) TELO2 interacting protein 1
Horse(100055499) TELO2 interacting protein 1
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302645 ANTI-K0406 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4301632 Anti-TTI1 affinity isolated antibody human, mouse
immunohistochemistry pricing
HPA068338 Anti-TTI1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
PLA0280 Rabbit anti-TTI1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, primate, mouse, rhesus monkey, chimpanzee, bovine, horse, Chinese hamster, pig, marmoset, rat, gorilla
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014657 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014657 Rosetta Predictions human pricing
NM_001134619 Rosetta Predictions rat pricing
NM_029282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247404 predicted 3250
2 SASI_Hs01_00247405 predicted 2984
3 SASI_Hs01_00247406 predicted 1379
4 SASI_Hs01_00247408 predicted 858
5 SASI_Hs01_00247409 predicted 1685
6 SASI_Hs01_00247410 predicted 1726
7 SASI_Hs02_00345994 predicted 1240
8 SASI_Hs02_00345995 predicted 2672
9 SASI_Hs02_00345996 predicted 1055
10 SASI_Hs01_00247412 predicted 1685
11 SASI_Hs01_00247407 predicted 2005
12 SASI_Hs01_00247411 predicted 2303
13 SASI_Hs01_00247413 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257669 predicted 1458
2 SASI_Rn02_00257670 predicted 2703
3 SASI_Rn02_00257671 predicted 415
4 SASI_Rn02_00257672 predicted 2637
5 SASI_Rn02_00257673 predicted 2120
6 SASI_Rn02_00257674 predicted 2133
7 SASI_Rn02_00257675 predicted 1694
8 SASI_Rn02_00257676 predicted 432
9 SASI_Rn02_00257677 predicted 2521
10 SASI_Rn02_00257678 predicted 1916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045602 predicted 1996
2 SASI_Mm02_00335084 predicted 1700
3 SASI_Mm01_00045603 predicted 567
4 SASI_Mm01_00045604 predicted 2055
5 SASI_Mm01_00045605 predicted 2128
6 SASI_Mm01_00045606 predicted 1576
7 SASI_Mm01_00045608 predicted 1921
8 SASI_Mm01_00045609 predicted 431
9 SASI_Mm01_00045610 predicted 3377
10 SASI_Mm01_00045611 predicted 2091
11 SASI_Mm01_00045607 predicted 447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029282
VALIDATED
TTI1 MISSION shRNA Bacterial Glycerol Stock
TELO2 interacting protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-1615s21c1
Sequence:CCGGGCTGCCATGATCCTTAATGAACTCGAGTTCATTAAGGATCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-859s21c1
Sequence:CCGGGCCCTGATGATTCACAGAGAACTCGAGTTCTCTGTGAATCATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-2383s21c1
Sequence:CCGGCAACTCCAACAGCGTAGTTTACTCGAGTAAACTACGCTGTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-423s21c1
Sequence:CCGGCCAGGGACTTAGCACCTTAATCTCGAGATTAAGGTGCTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029282.1-3513s21c1
Sequence:CCGGGCTCTAAGAGTTTAACTCTTTCTCGAGAAAGAGTTAAACTCTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-3513s1c1
Sequence:CCGGGCTCTAAGAGTTTAACTCTTTCTCGAGAAAGAGTTAAACTCTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-423s1c1
Sequence:CCGGCCAGGGACTTAGCACCTTAATCTCGAGATTAAGGTGCTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-859s1c1
Sequence:CCGGGCCCTGATGATTCACAGAGAACTCGAGTTCTCTGTGAATCATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029282.1-1615s1c1
Sequence:CCGGGCTGCCATGATCCTTAATGAACTCGAGTTCATTAAGGATCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-2383s1c1
Sequence:CCGGCAACTCCAACAGCGTAGTTTACTCGAGTAAACTACGCTGTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029282
VALIDATED
TTI1 MISSION shRNA shRNA Plasmid DNA
TELO2 interacting protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-1615s21c1
Sequence:CCGGGCTGCCATGATCCTTAATGAACTCGAGTTCATTAAGGATCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-859s21c1
Sequence:CCGGGCCCTGATGATTCACAGAGAACTCGAGTTCTCTGTGAATCATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-2383s21c1
Sequence:CCGGCAACTCCAACAGCGTAGTTTACTCGAGTAAACTACGCTGTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-423s21c1
Sequence:CCGGCCAGGGACTTAGCACCTTAATCTCGAGATTAAGGTGCTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029282.1-3513s21c1
Sequence:CCGGGCTCTAAGAGTTTAACTCTTTCTCGAGAAAGAGTTAAACTCTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-3513s1c1
Sequence:CCGGGCTCTAAGAGTTTAACTCTTTCTCGAGAAAGAGTTAAACTCTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-423s1c1
Sequence:CCGGCCAGGGACTTAGCACCTTAATCTCGAGATTAAGGTGCTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-859s1c1
Sequence:CCGGGCCCTGATGATTCACAGAGAACTCGAGTTCTCTGTGAATCATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029282.1-1615s1c1
Sequence:CCGGGCTGCCATGATCCTTAATGAACTCGAGTTCATTAAGGATCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-2383s1c1
Sequence:CCGGCAACTCCAACAGCGTAGTTTACTCGAGTAAACTACGCTGTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029282
VALIDATED
TTI1 MISSION shRNA Lentiviral Transduction Particles
TELO2 interacting protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-1615s21c1
Sequence:CCGGGCTGCCATGATCCTTAATGAACTCGAGTTCATTAAGGATCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-859s21c1
Sequence:CCGGGCCCTGATGATTCACAGAGAACTCGAGTTCTCTGTGAATCATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-2383s21c1
Sequence:CCGGCAACTCCAACAGCGTAGTTTACTCGAGTAAACTACGCTGTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029282.1-423s21c1
Sequence:CCGGCCAGGGACTTAGCACCTTAATCTCGAGATTAAGGTGCTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029282.1-3513s21c1
Sequence:CCGGGCTCTAAGAGTTTAACTCTTTCTCGAGAAAGAGTTAAACTCTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-3513s1c1
Sequence:CCGGGCTCTAAGAGTTTAACTCTTTCTCGAGAAAGAGTTAAACTCTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-423s1c1
Sequence:CCGGCCAGGGACTTAGCACCTTAATCTCGAGATTAAGGTGCTAAGTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-859s1c1
Sequence:CCGGGCCCTGATGATTCACAGAGAACTCGAGTTCTCTGTGAATCATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029282.1-1615s1c1
Sequence:CCGGGCTGCCATGATCCTTAATGAACTCGAGTTCATTAAGGATCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029282.1-2383s1c1
Sequence:CCGGCAACTCCAACAGCGTAGTTTACTCGAGTAAACTACGCTGTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014657
TTI1 MISSION shRNA Bacterial Glycerol Stock
TELO2 interacting protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-2676s1c1
Sequence:CCGGGCAGATGGAAATGTCTCGGATCTCGAGATCCGAGACATTTCCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014657.1-3727s1c1
Sequence:CCGGCCCTTAGCCTACCATCTCTATCTCGAGATAGAGATGGTAGGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014657.1-3618s1c1
Sequence:CCGGCGATCACACAACTGCTTAGAACTCGAGTTCTAAGCAGTTGTGTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-899s1c1
Sequence:CCGGCATTGTCGTATCTTCCCTAAACTCGAGTTTAGGGAAGATACGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-1171s1c1
Sequence:CCGGGCAGTCAATCATTGGTCGAATCTCGAGATTCGACCAATGATTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-1060s1c1
Sequence:CCGGGCGACAAGTTGACTATCCTTACTCGAGTAAGGATAGTCAACTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014657
TTI1 MISSION shRNA shRNA Plasmid DNA
TELO2 interacting protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-2676s1c1
Sequence:CCGGGCAGATGGAAATGTCTCGGATCTCGAGATCCGAGACATTTCCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014657.1-3727s1c1
Sequence:CCGGCCCTTAGCCTACCATCTCTATCTCGAGATAGAGATGGTAGGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014657.1-3618s1c1
Sequence:CCGGCGATCACACAACTGCTTAGAACTCGAGTTCTAAGCAGTTGTGTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-899s1c1
Sequence:CCGGCATTGTCGTATCTTCCCTAAACTCGAGTTTAGGGAAGATACGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-1171s1c1
Sequence:CCGGGCAGTCAATCATTGGTCGAATCTCGAGATTCGACCAATGATTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-1060s1c1
Sequence:CCGGGCGACAAGTTGACTATCCTTACTCGAGTAAGGATAGTCAACTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014657
TTI1 MISSION shRNA Lentiviral Transduction Particles
TELO2 interacting protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-2676s1c1
Sequence:CCGGGCAGATGGAAATGTCTCGGATCTCGAGATCCGAGACATTTCCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014657.1-3727s1c1
Sequence:CCGGCCCTTAGCCTACCATCTCTATCTCGAGATAGAGATGGTAGGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162037    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014657.1-3618s1c1
Sequence:CCGGCGATCACACAACTGCTTAGAACTCGAGTTCTAAGCAGTTGTGTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-899s1c1
Sequence:CCGGCATTGTCGTATCTTCCCTAAACTCGAGTTTAGGGAAGATACGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-1171s1c1
Sequence:CCGGGCAGTCAATCATTGGTCGAATCTCGAGATTCGACCAATGATTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014657.1-1060s1c1
Sequence:CCGGGCGACAAGTTGACTATCCTTACTCGAGTAAGGATAGTCAACTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks