EMAIL THIS PAGE TO A FRIEND

TTI2

TELO2 interacting protein 2

Synonyms: C8orf41
UniProtKB ID: Q6NXR4, D3DSV7, Q96IM2, Q9H5N4
Gene ID:
Human(80185) Summary: This gene encodes a regulator of the DNA damage response. The protein is a component of the Triple T complex (TTT) which also includes telomere length regulation protein and TELO2 interacting protein 1. The TTT complex is involved in cellular resistance to DNA damage stresses and may act as a regulator of phosphoinositide-3-kinase-related protein kinase (PIKK) abundance. [provided by RefSeq, May 2013]
Mouse(234138) TELO2 interacting protein 2
Rat(290811) TELO2 interacting protein 2
Zebrafish(100334230) TELO2 interacting protein 2
domestic cat(101097888) TELO2 interacting protein 2
dog(608405) TELO2 interacting protein 2
chicken(426923) chromosome 8 open reading frame 41
naked mole-rat(101719521) TELO2 interacting protein 2
domestic guinea pig(100721725) TELO2 interacting protein 2
cow(535350) TELO2 interacting protein 2
sheep(101108629) TELO2 interacting protein 2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025115 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102401 Rosetta Predictions human pricing
NM_025115 Rosetta Predictions human pricing
NM_001013883 Rosetta Predictions rat pricing
NM_001112729 Rosetta Predictions mouse pricing
NM_144927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323083 predicted 854
2 SASI_Hs02_00323084 predicted 1771
3 SASI_Hs02_00323085 predicted 1582
4 SASI_Hs02_00323086 predicted 574
5 SASI_Hs02_00323087 predicted 1045
6 SASI_Hs02_00323088 predicted 1322
7 SASI_Hs02_00323089 predicted 1813
8 SASI_Hs02_00323090 predicted 798
9 SASI_Hs02_00323091 predicted 817
10 SASI_Hs02_00323092 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129846 predicted 1182
2 SASI_Hs02_00357815 predicted 2094
3 SASI_Hs02_00357816 predicted 1904
4 SASI_Hs01_00129848 predicted 893
5 SASI_Hs01_00129849 predicted 1362
6 SASI_Hs01_00129851 predicted 1641
7 SASI_Hs02_00357817 predicted 2136
8 SASI_Hs01_00129853 predicted 1125
9 SASI_Hs01_00129854 predicted 1133
10 SASI_Hs02_00357818 predicted 1112
11 SASI_Hs01_00129847 predicted 605
12 SASI_Hs01_00129850 predicted 1306
13 SASI_Hs01_00129852 predicted 994
14 SASI_Hs01_00129855 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046668 predicted 664
2 SASI_Rn01_00046669 predicted 1450
3 SASI_Rn01_00046670 predicted 1463
4 SASI_Rn01_00046672 predicted 949
5 SASI_Rn01_00046673 predicted 620
6 SASI_Rn01_00046674 predicted 809
7 SASI_Rn01_00046675 predicted 421
8 SASI_Rn01_00046676 predicted 437
9 SASI_Rn01_00046677 predicted 720
10 SASI_Rn02_00201159 predicted 1544
11 SASI_Rn01_00046671 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307043 predicted 1698
2 SASI_Mm02_00307044 predicted 1807
3 SASI_Mm02_00307045 predicted 1302
4 SASI_Mm02_00307046 predicted 1198
5 SASI_Mm02_00307047 predicted 1548
6 SASI_Mm02_00307048 predicted 1762
7 SASI_Mm02_00307049 predicted 1253
8 SASI_Mm02_00307050 predicted 1661
9 SASI_Mm02_00307051 predicted 963
10 SASI_Mm02_00307052 predicted 1762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340432 predicted 1694
2 SASI_Mm02_00340433 predicted 1803
3 SASI_Mm02_00340434 predicted 1302
4 SASI_Mm02_00340435 predicted 1198
5 SASI_Mm02_00340436 predicted 1548
6 SASI_Mm02_00340437 predicted 1758
7 SASI_Mm02_00340438 predicted 1251
8 SASI_Mm02_00340439 predicted 1659
9 SASI_Mm02_00340440 predicted 968
10 SASI_Mm02_00340441 predicted 1770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144927
TTI2 MISSION shRNA Bacterial Glycerol Stock
TELO2 interacting protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144927.2-1314s1c1
Sequence:CCGGGACTATCAGACAGAGAATAAACTCGAGTTTATTCTCTGTCTGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144927.2-2385s1c1
Sequence:CCGGGCTCCACTGAAGTGACATAAACTCGAGTTTATGTCACTTCAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144927.2-678s1c1
Sequence:CCGGGCAAGAAATGCGGCTCTTAAACTCGAGTTTAAGAGCCGCATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144927.3-1702s1c1
Sequence:CCGGCTTGGTTATCTGGAGGTTTATCTCGAGATAAACCTCCAGATAACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-972s21c1
Sequence:CCGGCATGTCAGGACCCGTGTATATCTCGAGATATACACGGGTCCTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-1702s21c1
Sequence:CCGGCTTGGTTATCTGGAGGTTTATCTCGAGATAAACCTCCAGATAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-672s21c1
Sequence:CCGGCGCAAGAAATGCGGCTCTTAACTCGAGTTAAGAGCCGCATTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-719s21c1
Sequence:CCGGCCGAAGGTGACAGATTCTTTGCTCGAGCAAAGAATCTGTCACCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144927
TTI2 MISSION shRNA shRNA Plasmid DNA
TELO2 interacting protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144927.2-1314s1c1
Sequence:CCGGGACTATCAGACAGAGAATAAACTCGAGTTTATTCTCTGTCTGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144927.2-2385s1c1
Sequence:CCGGGCTCCACTGAAGTGACATAAACTCGAGTTTATGTCACTTCAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144927.2-678s1c1
Sequence:CCGGGCAAGAAATGCGGCTCTTAAACTCGAGTTTAAGAGCCGCATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144927.3-1702s1c1
Sequence:CCGGCTTGGTTATCTGGAGGTTTATCTCGAGATAAACCTCCAGATAACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-972s21c1
Sequence:CCGGCATGTCAGGACCCGTGTATATCTCGAGATATACACGGGTCCTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-1702s21c1
Sequence:CCGGCTTGGTTATCTGGAGGTTTATCTCGAGATAAACCTCCAGATAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-672s21c1
Sequence:CCGGCGCAAGAAATGCGGCTCTTAACTCGAGTTAAGAGCCGCATTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-719s21c1
Sequence:CCGGCCGAAGGTGACAGATTCTTTGCTCGAGCAAAGAATCTGTCACCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144927
TTI2 MISSION shRNA Lentiviral Transduction Particles
TELO2 interacting protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144927.2-1314s1c1
Sequence:CCGGGACTATCAGACAGAGAATAAACTCGAGTTTATTCTCTGTCTGATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190503    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144927.2-2385s1c1
Sequence:CCGGGCTCCACTGAAGTGACATAAACTCGAGTTTATGTCACTTCAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144927.2-678s1c1
Sequence:CCGGGCAAGAAATGCGGCTCTTAAACTCGAGTTTAAGAGCCGCATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144927.3-1702s1c1
Sequence:CCGGCTTGGTTATCTGGAGGTTTATCTCGAGATAAACCTCCAGATAACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-972s21c1
Sequence:CCGGCATGTCAGGACCCGTGTATATCTCGAGATATACACGGGTCCTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-1702s21c1
Sequence:CCGGCTTGGTTATCTGGAGGTTTATCTCGAGATAAACCTCCAGATAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-672s21c1
Sequence:CCGGCGCAAGAAATGCGGCTCTTAACTCGAGTTAAGAGCCGCATTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144927.3-719s21c1
Sequence:CCGGCCGAAGGTGACAGATTCTTTGCTCGAGCAAAGAATCTGTCACCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025115
VALIDATED
TTI2 MISSION shRNA Bacterial Glycerol Stock
TELO2 interacting protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025115.1-1990s1c1
Sequence:CCGGCCCATCCCAATTTGTATGAATCTCGAGATTCATACAAATTGGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-1176s1c1
Sequence:CCGGGCATCATTGGTCATTTCAGATCTCGAGATCTGAAATGACCAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-1635s1c1
Sequence:CCGGCTGAAGATATTGGAAACCCTACTCGAGTAGGGTTTCCAATATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025115.1-576s1c1
Sequence:CCGGGTTCTTAAAGACCTCGGTGATCTCGAGATCACCGAGGTCTTTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025115.1-1227s1c1
Sequence:CCGGGTACACTGTCTCCATCACATTCTCGAGAATGTGATGGAGACAGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-765s1c1
Sequence:CCGGGCCCAAGTTGGGTTACTGTTTCTCGAGAAACAGTAACCCAACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-453s1c1
Sequence:CCGGCCATCGCAGGAAGACTCTAATCTCGAGATTAGAGTCTTCCTGCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025115.1-606s1c1
Sequence:CCGGGCCACAGGATTTGATAGGTTACTCGAGTAACCTATCAAATCCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025115.2-1690s21c1
Sequence:CCGGATTGGTTATCTGGAGGTTTATCTCGAGATAAACCTCCAGATAACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025115.2-2313s21c1
Sequence:CCGGCCGTCATCTCATCCCAGATTCCTCGAGGAATCTGGGATGAGATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025115.2-2142s21c1
Sequence:CCGGACGAAACTTTGTAAGTGAAAGCTCGAGCTTTCACTTACAAAGTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025115.2-2091s21c1
Sequence:CCGGCCATCCCAATTTGTATGAATGCTCGAGCATTCATACAAATTGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025115
VALIDATED
TTI2 MISSION shRNA shRNA Plasmid DNA
TELO2 interacting protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025115.1-1990s1c1
Sequence:CCGGCCCATCCCAATTTGTATGAATCTCGAGATTCATACAAATTGGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-1176s1c1
Sequence:CCGGGCATCATTGGTCATTTCAGATCTCGAGATCTGAAATGACCAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-1635s1c1
Sequence:CCGGCTGAAGATATTGGAAACCCTACTCGAGTAGGGTTTCCAATATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025115.1-576s1c1
Sequence:CCGGGTTCTTAAAGACCTCGGTGATCTCGAGATCACCGAGGTCTTTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025115.1-1227s1c1
Sequence:CCGGGTACACTGTCTCCATCACATTCTCGAGAATGTGATGGAGACAGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-765s1c1
Sequence:CCGGGCCCAAGTTGGGTTACTGTTTCTCGAGAAACAGTAACCCAACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-453s1c1
Sequence:CCGGCCATCGCAGGAAGACTCTAATCTCGAGATTAGAGTCTTCCTGCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025115.1-606s1c1
Sequence:CCGGGCCACAGGATTTGATAGGTTACTCGAGTAACCTATCAAATCCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025115.2-1690s21c1
Sequence:CCGGATTGGTTATCTGGAGGTTTATCTCGAGATAAACCTCCAGATAACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025115.2-2313s21c1
Sequence:CCGGCCGTCATCTCATCCCAGATTCCTCGAGGAATCTGGGATGAGATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025115.2-2142s21c1
Sequence:CCGGACGAAACTTTGTAAGTGAAAGCTCGAGCTTTCACTTACAAAGTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025115.2-2091s21c1
Sequence:CCGGCCATCCCAATTTGTATGAATGCTCGAGCATTCATACAAATTGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025115
VALIDATED
TTI2 MISSION shRNA Lentiviral Transduction Particles
TELO2 interacting protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025115.1-1990s1c1
Sequence:CCGGCCCATCCCAATTTGTATGAATCTCGAGATTCATACAAATTGGGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-1176s1c1
Sequence:CCGGGCATCATTGGTCATTTCAGATCTCGAGATCTGAAATGACCAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-1635s1c1
Sequence:CCGGCTGAAGATATTGGAAACCCTACTCGAGTAGGGTTTCCAATATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025115.1-576s1c1
Sequence:CCGGGTTCTTAAAGACCTCGGTGATCTCGAGATCACCGAGGTCTTTAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025115.1-1227s1c1
Sequence:CCGGGTACACTGTCTCCATCACATTCTCGAGAATGTGATGGAGACAGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-765s1c1
Sequence:CCGGGCCCAAGTTGGGTTACTGTTTCTCGAGAAACAGTAACCCAACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_025115.1-453s1c1
Sequence:CCGGCCATCGCAGGAAGACTCTAATCTCGAGATTAGAGTCTTCCTGCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025115.1-606s1c1
Sequence:CCGGGCCACAGGATTTGATAGGTTACTCGAGTAACCTATCAAATCCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025115.2-1690s21c1
Sequence:CCGGATTGGTTATCTGGAGGTTTATCTCGAGATAAACCTCCAGATAACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025115.2-2313s21c1
Sequence:CCGGCCGTCATCTCATCCCAGATTCCTCGAGGAATCTGGGATGAGATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025115.2-2142s21c1
Sequence:CCGGACGAAACTTTGTAAGTGAAAGCTCGAGCTTTCACTTACAAAGTTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025115.2-2091s21c1
Sequence:CCGGCCATCCCAATTTGTATGAATGCTCGAGCATTCATACAAATTGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks