EMAIL THIS PAGE TO A FRIEND

TTK

TTK protein kinase

Synonyms: CT96 ESK MPH1 MPS1 MPS1L1 PYT
Gene ID:
Human(7272) Summary: This gene encodes a dual specificity protein kinase with the ability to phosphorylate tyrosine, serine and threonine. Associated with cell proliferation, this protein is essential for chromosome alignment at the centromere during mitosis and is required for centrosome duplication. It has been found to be a critical mitotic checkpoint protein for accurate segregation of chromosomes during mitosis. Tumorigenesis may occur when this protein fails to degrade and produces excess centrosomes resulting in aberrant mitotic spindles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Mouse(22137) Ttk protein kinase
Rat(315852) Ttk protein kinase
fruit fly(48317) tramtrack
Zebrafish(317763) ttk protein kinase
dog(481895) TTK protein kinase
Horse(100069586) TTK protein kinase
domestic cat(101101566) TTK protein kinase
chicken(421849) TTK protein kinase
cow(524925) TTK protein kinase
sheep(101113682) TTK protein kinase
domestic guinea pig(100723582) TTK protein kinase
naked mole-rat(101702153) TTK protein kinase
Domestic Rabbit(100359213) TTK protein kinase
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003318 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003318 Rosetta Predictions human pricing
NM_001108172 Rosetta Predictions rat pricing
NM_001110265 Rosetta Predictions mouse pricing
NM_009445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036256 predicted 1893
2 SASI_Hs01_00036257 predicted 2017
3 SASI_Hs01_00036258 predicted 1980
4 SASI_Hs01_00036260 predicted 2043
5 SASI_Hs02_00335447 predicted 398
6 SASI_Hs01_00036262 predicted 2328
7 SASI_Hs02_00335448 predicted 209
8 SASI_Hs01_00036263 predicted 773
9 SASI_Hs01_00036264 predicted 975
10 SASI_Hs01_00036265 predicted 962
11 SASI_Hs01_00036259 predicted 2223
12 SASI_Hs01_00036261 predicted 2095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236054 predicted 2555
2 SASI_Rn02_00236055 predicted 1662
3 SASI_Rn02_00236056 predicted 1072
4 SASI_Rn02_00236057 predicted 2079
5 SASI_Rn02_00236058 predicted 1752
6 SASI_Rn02_00236059 predicted 2064
7 SASI_Rn02_00236060 predicted 2378
8 SASI_Rn02_00236061 predicted 1736
9 SASI_Rn02_00236062 predicted 2310
10 SASI_Rn02_00236063 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110265 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305196 predicted 2221
2 SASI_Mm02_00305197 predicted 1974
3 SASI_Mm02_00305198 predicted 2024
4 SASI_Mm02_00305199 predicted 2266
5 SASI_Mm02_00305200 predicted 1955
6 SASI_Mm02_00305201 predicted 219
7 SASI_Mm02_00305202 predicted 2204
8 SASI_Mm02_00305203 predicted 1594
9 SASI_Mm02_00305204 predicted 1792
10 SASI_Mm02_00305205 predicted 1694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134280 predicted 2227
2 SASI_Mm02_00316145 predicted 1967
3 SASI_Mm01_00134282 predicted 2018
4 SASI_Mm02_00316146 predicted 2257
5 SASI_Mm02_00316147 predicted 1948
6 SASI_Mm02_00316148 predicted 219
7 SASI_Mm02_00316149 predicted 2197
8 SASI_Mm02_00316150 predicted 1595
9 SASI_Mm01_00134288 predicted 1789
10 SASI_Mm01_00134289 predicted 1695
11 SASI_Mm01_00134281 predicted 2455
12 SASI_Mm01_00134283 predicted 925
13 SASI_Mm01_00134284 predicted 2363
14 SASI_Mm01_00134285 predicted 2470
15 SASI_Mm01_00134286 predicted 2497
16 SASI_Mm01_00134287 predicted 1064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009445
VALIDATED
TTK MISSION shRNA Bacterial Glycerol Stock
TTK protein kinase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009445.2-2057s21c1
Sequence:CCGGGGTTGGCACAGTTAACTATATCTCGAGATATAGTTAACTGTGCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2294s21c1
Sequence:CCGGAGATCTTCGAGACGTGTTAAACTCGAGTTTAACACGTCTCGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2231s21c1
Sequence:CCGGCTCTAAACTGCACGCCATAATCTCGAGATTATGGCGTGCAGTTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2266s21c1
Sequence:CCGGAGATTGAATTTCCCGAGATTTCTCGAGAAATCTCGGGAAATTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-1036s21c1
Sequence:CCGGCCTATGAACTGAGAGGTTTAACTCGAGTTAAACCTCTCAGTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2601s21c1
Sequence:CCGGCCAAGAACACTAGATTGTTTCCTCGAGGAAACAATCTAGTGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009445.1-1343s1c1
Sequence:CCGGCCACCAATATCAGTTCCTAAACTCGAGTTTAGGAACTGATATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009445.1-1548s1c1
Sequence:CCGGGCTTGCAGATTTCAGGTTCTTCTCGAGAAGAACCTGAAATCTGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009445.1-323s1c1
Sequence:CCGGCCAGATAAATACGGCCAGAATCTCGAGATTCTGGCCGTATTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009445.1-2447s1c1
Sequence:CCGGGCCACTGATGAAATGAAATATCTCGAGATATTTCATTTCATCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009445.1-473s1c1
Sequence:CCGGGCACAGTTTGAACTGTCTCAACTCGAGTTGAGACAGTTCAAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009445
VALIDATED
TTK MISSION shRNA shRNA Plasmid DNA
TTK protein kinase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009445.2-2057s21c1
Sequence:CCGGGGTTGGCACAGTTAACTATATCTCGAGATATAGTTAACTGTGCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2294s21c1
Sequence:CCGGAGATCTTCGAGACGTGTTAAACTCGAGTTTAACACGTCTCGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2231s21c1
Sequence:CCGGCTCTAAACTGCACGCCATAATCTCGAGATTATGGCGTGCAGTTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2266s21c1
Sequence:CCGGAGATTGAATTTCCCGAGATTTCTCGAGAAATCTCGGGAAATTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-1036s21c1
Sequence:CCGGCCTATGAACTGAGAGGTTTAACTCGAGTTAAACCTCTCAGTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2601s21c1
Sequence:CCGGCCAAGAACACTAGATTGTTTCCTCGAGGAAACAATCTAGTGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009445.1-1343s1c1
Sequence:CCGGCCACCAATATCAGTTCCTAAACTCGAGTTTAGGAACTGATATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009445.1-1548s1c1
Sequence:CCGGGCTTGCAGATTTCAGGTTCTTCTCGAGAAGAACCTGAAATCTGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009445.1-323s1c1
Sequence:CCGGCCAGATAAATACGGCCAGAATCTCGAGATTCTGGCCGTATTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009445.1-2447s1c1
Sequence:CCGGGCCACTGATGAAATGAAATATCTCGAGATATTTCATTTCATCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009445.1-473s1c1
Sequence:CCGGGCACAGTTTGAACTGTCTCAACTCGAGTTGAGACAGTTCAAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009445
VALIDATED
TTK MISSION shRNA Lentiviral Transduction Particles
TTK protein kinase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009445.2-2057s21c1
Sequence:CCGGGGTTGGCACAGTTAACTATATCTCGAGATATAGTTAACTGTGCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2294s21c1
Sequence:CCGGAGATCTTCGAGACGTGTTAAACTCGAGTTTAACACGTCTCGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2231s21c1
Sequence:CCGGCTCTAAACTGCACGCCATAATCTCGAGATTATGGCGTGCAGTTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2266s21c1
Sequence:CCGGAGATTGAATTTCCCGAGATTTCTCGAGAAATCTCGGGAAATTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-1036s21c1
Sequence:CCGGCCTATGAACTGAGAGGTTTAACTCGAGTTAAACCTCTCAGTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009445.2-2601s21c1
Sequence:CCGGCCAAGAACACTAGATTGTTTCCTCGAGGAAACAATCTAGTGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009445.1-1343s1c1
Sequence:CCGGCCACCAATATCAGTTCCTAAACTCGAGTTTAGGAACTGATATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009445.1-1548s1c1
Sequence:CCGGGCTTGCAGATTTCAGGTTCTTCTCGAGAAGAACCTGAAATCTGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009445.1-323s1c1
Sequence:CCGGCCAGATAAATACGGCCAGAATCTCGAGATTCTGGCCGTATTTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009445.1-2447s1c1
Sequence:CCGGGCCACTGATGAAATGAAATATCTCGAGATATTTCATTTCATCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009445.1-473s1c1
Sequence:CCGGGCACAGTTTGAACTGTCTCAACTCGAGTTGAGACAGTTCAAACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003318
VALIDATED
TTK MISSION shRNA Bacterial Glycerol Stock
TTK protein kinase
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-522s21c1
Sequence:CCGGGCACAATTTGAACTGTCACAACTCGAGTTGTGACAGTTCAAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-2515s21c1
Sequence:CCGGGCCAACTTGTTGGTCTGAATTCTCGAGAATTCAGACCAACAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-1821s21c1
Sequence:CCGGGATAAGATCATCCGACTTTATCTCGAGATAAAGTCGGATGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-694s21c1
Sequence:CCGGCGGTATTAACTGCCCAAGAATCTCGAGATTCTTGGGCAGTTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-694s1c1
Sequence:CCGGCGGTATTAACTGCCCAAGAATCTCGAGATTCTTGGGCAGTTAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-522s1c1
Sequence:CCGGGCACAATTTGAACTGTCACAACTCGAGTTGTGACAGTTCAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-1479s1c1
Sequence:CCGGCCAGTTGTAAAGAATGACTTTCTCGAGAAAGTCATTCTTTACAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2515s1c1
Sequence:CCGGGCCAACTTGTTGGTCTGAATTCTCGAGAATTCAGACCAACAAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2809s1c1
Sequence:CCGGGCAACCACTTATGGTACTGTACTCGAGTACAGTACCATAAGTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2025s1c1
Sequence:CCGGGCTAACTTTCTGATAGTTGATCTCGAGATCAACTATCAGAAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2311s1c1
Sequence:CCGGCCATAATTGATCCTAATCATGCTCGAGCATGATTAGGATCAATTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-1779s1c1
Sequence:CCGGCGGAACGAAATAGCTTATTTGCTCGAGCAAATAAGCTATTTCGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-1821s1c1
Sequence:CCGGGATAAGATCATCCGACTTTATCTCGAGATAAAGTCGGATGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003318.3-2662s1c1
Sequence:CCGGGTAATGTCAAATACCACCTATCTCGAGATAGGTGGTATTTGACATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003318.3-411s1c1
Sequence:CCGGCAAGTGAGATTTGCTGAATTACTCGAGTAATTCAGCAAATCTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003318.3-220s1c1
Sequence:CCGGCGGGAACTGTTAACCAAATTACTCGAGTAATTTGGTTAACAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003318
VALIDATED
TTK MISSION shRNA shRNA Plasmid DNA
TTK protein kinase
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-522s21c1
Sequence:CCGGGCACAATTTGAACTGTCACAACTCGAGTTGTGACAGTTCAAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-2515s21c1
Sequence:CCGGGCCAACTTGTTGGTCTGAATTCTCGAGAATTCAGACCAACAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-1821s21c1
Sequence:CCGGGATAAGATCATCCGACTTTATCTCGAGATAAAGTCGGATGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-694s21c1
Sequence:CCGGCGGTATTAACTGCCCAAGAATCTCGAGATTCTTGGGCAGTTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-694s1c1
Sequence:CCGGCGGTATTAACTGCCCAAGAATCTCGAGATTCTTGGGCAGTTAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-522s1c1
Sequence:CCGGGCACAATTTGAACTGTCACAACTCGAGTTGTGACAGTTCAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-1479s1c1
Sequence:CCGGCCAGTTGTAAAGAATGACTTTCTCGAGAAAGTCATTCTTTACAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2515s1c1
Sequence:CCGGGCCAACTTGTTGGTCTGAATTCTCGAGAATTCAGACCAACAAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2809s1c1
Sequence:CCGGGCAACCACTTATGGTACTGTACTCGAGTACAGTACCATAAGTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2025s1c1
Sequence:CCGGGCTAACTTTCTGATAGTTGATCTCGAGATCAACTATCAGAAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2311s1c1
Sequence:CCGGCCATAATTGATCCTAATCATGCTCGAGCATGATTAGGATCAATTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-1779s1c1
Sequence:CCGGCGGAACGAAATAGCTTATTTGCTCGAGCAAATAAGCTATTTCGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-1821s1c1
Sequence:CCGGGATAAGATCATCCGACTTTATCTCGAGATAAAGTCGGATGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003318.3-2662s1c1
Sequence:CCGGGTAATGTCAAATACCACCTATCTCGAGATAGGTGGTATTTGACATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003318.3-411s1c1
Sequence:CCGGCAAGTGAGATTTGCTGAATTACTCGAGTAATTCAGCAAATCTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003318.3-220s1c1
Sequence:CCGGCGGGAACTGTTAACCAAATTACTCGAGTAATTTGGTTAACAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003318
VALIDATED
TTK MISSION shRNA Lentiviral Transduction Particles
TTK protein kinase
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-522s21c1
Sequence:CCGGGCACAATTTGAACTGTCACAACTCGAGTTGTGACAGTTCAAATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-2515s21c1
Sequence:CCGGGCCAACTTGTTGGTCTGAATTCTCGAGAATTCAGACCAACAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-1821s21c1
Sequence:CCGGGATAAGATCATCCGACTTTATCTCGAGATAAAGTCGGATGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003318.3-694s21c1
Sequence:CCGGCGGTATTAACTGCCCAAGAATCTCGAGATTCTTGGGCAGTTAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-694s1c1
Sequence:CCGGCGGTATTAACTGCCCAAGAATCTCGAGATTCTTGGGCAGTTAATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-522s1c1
Sequence:CCGGGCACAATTTGAACTGTCACAACTCGAGTTGTGACAGTTCAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-1479s1c1
Sequence:CCGGCCAGTTGTAAAGAATGACTTTCTCGAGAAAGTCATTCTTTACAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2515s1c1
Sequence:CCGGGCCAACTTGTTGGTCTGAATTCTCGAGAATTCAGACCAACAAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2809s1c1
Sequence:CCGGGCAACCACTTATGGTACTGTACTCGAGTACAGTACCATAAGTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2025s1c1
Sequence:CCGGGCTAACTTTCTGATAGTTGATCTCGAGATCAACTATCAGAAAGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-2311s1c1
Sequence:CCGGCCATAATTGATCCTAATCATGCTCGAGCATGATTAGGATCAATTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-1779s1c1
Sequence:CCGGCGGAACGAAATAGCTTATTTGCTCGAGCAAATAAGCTATTTCGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003318.3-1821s1c1
Sequence:CCGGGATAAGATCATCCGACTTTATCTCGAGATAAAGTCGGATGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003318.3-2662s1c1
Sequence:CCGGGTAATGTCAAATACCACCTATCTCGAGATAGGTGGTATTTGACATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003318.3-411s1c1
Sequence:CCGGCAAGTGAGATTTGCTGAATTACTCGAGTAATTCAGCAAATCTCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003318.3-220s1c1
Sequence:CCGGCGGGAACTGTTAACCAAATTACTCGAGTAATTTGGTTAACAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks