EMAIL THIS PAGE TO A FRIEND

TTL

tubulin tyrosine ligase

UniProtKB ID: Q8NG68, Q585T3, Q7Z302, Q8N426
Gene ID:
Human(150465) Summary: TTL is a cytosolic enzyme involved in the posttranslational modification of alpha-tubulin (see MIM 602529). Alpha-tubulin within assembled microtubules is detyrosinated over time at the C terminus. After microtubule disassembly, TTL restores the tyrosine residues and consequently participates in a cycle of tubulin detyrosination and tyrosination (Erck et al., 2003 [PubMed 14571137]
Mouse(69737) tubulin tyrosine ligase
Rat(171572) tubulin tyrosine ligase
naked mole-rat(101701462) tubulin tyrosine ligase
domestic guinea pig(100723990) tubulin tyrosine ligase
cow(514559) tubulin tyrosine ligase
sheep(101107272) tubulin tyrosine ligase
Thale Cress(835934) transthyretin-like protein
chicken(416711) tubulin tyrosine ligase
Zebrafish(767687) tubulin tyrosine ligase
dog(483065) tubulin tyrosine ligase
domestic cat(101082558) tubulin tyrosine ligase
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153712 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153712 Rosetta Predictions human pricing
NM_138536 Rosetta Predictions rat pricing
NM_027192 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198137 predicted 970
2 SASI_Hs02_00367440 predicted 453
3 SASI_Hs01_00198138 predicted 1015
4 SASI_Hs01_00198139 predicted 1124
5 SASI_Hs01_00198142 predicted 1402
6 SASI_Hs01_00198141 predicted 519
7 SASI_Hs01_00198143 predicted 532
8 SASI_Hs01_00198144 predicted 806
9 SASI_Hs01_00198145 predicted 990
10 SASI_Hs01_00198146 predicted 453
11 SASI_Hs01_00198140 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268170 predicted 953
2 SASI_Rn01_00081186 predicted 820
3 SASI_Rn01_00081188 predicted 435
4 SASI_Rn01_00081189 predicted 623
5 SASI_Rn01_00081190 predicted 830
6 SASI_Rn02_00268171 predicted 994
7 SASI_Rn01_00081191 predicted 919
8 SASI_Rn01_00081192 predicted 770
9 SASI_Rn01_00081193 predicted 843
10 SASI_Rn02_00268172 predicted 517
11 SASI_Rn01_00081185 predicted 578
12 SASI_Rn01_00081187 predicted 868
13 SASI_Rn01_00081194 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072583 predicted 962
2 SASI_Mm01_00072584 predicted 920
3 SASI_Mm01_00072585 predicted 1051
4 SASI_Mm01_00072586 predicted 825
5 SASI_Mm01_00072587 predicted 994
6 SASI_Mm01_00072588 predicted 493
7 SASI_Mm01_00072589 predicted 890
8 SASI_Mm01_00072590 predicted 978
9 SASI_Mm01_00072591 predicted 419
10 SASI_Mm01_00072592 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027192
VALIDATED
TTL MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202319    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027192.1-1445s1c1
Sequence:CCGGGCAGGAAGAGTGTGAAGAGATCTCGAGATCTCTTCACACTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-934s1c1
Sequence:CCGGGCATTCAGAAAGAGTACTCAACTCGAGTTGAGTACTCTTTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-493s1c1
Sequence:CCGGCGTATGTGATTTATCCAACTACTCGAGTAGTTGGATAAATCACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-1384s1c1
Sequence:CCGGCTCCAGAGGAAAGAGAGAGAACTCGAGTTCTCTCTCTTTCCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-950s1c1
Sequence:CCGGCTCAAAGAACTATGGGAAATACTCGAGTATTTCCCATAGTTCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-877s1c1
Sequence:CCGGCAGAACCATATCATGTTGATACTCGAGTATCAACATGATATGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-877s21c1
Sequence:CCGGCAGAACCATATCATGTTGATACTCGAGTATCAACATGATATGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027192.1-992s1c1
Sequence:CCGGCTTCGAAGAGTTCAATCAGTACTCGAGTACTGATTGAACTCTTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-493s21c1
Sequence:CCGGCGTATGTGATTTATCCAACTACTCGAGTAGTTGGATAAATCACATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-934s21c1
Sequence:CCGGGCATTCAGAAAGAGTACTCAACTCGAGTTGAGTACTCTTTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027192.1-1384s21c1
Sequence:CCGGCTCCAGAGGAAAGAGAGAGAACTCGAGTTCTCTCTCTTTCCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-950s21c1
Sequence:CCGGCTCAAAGAACTATGGGAAATACTCGAGTATTTCCCATAGTTCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027192
VALIDATED
TTL MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202319    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027192.1-1445s1c1
Sequence:CCGGGCAGGAAGAGTGTGAAGAGATCTCGAGATCTCTTCACACTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-934s1c1
Sequence:CCGGGCATTCAGAAAGAGTACTCAACTCGAGTTGAGTACTCTTTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-493s1c1
Sequence:CCGGCGTATGTGATTTATCCAACTACTCGAGTAGTTGGATAAATCACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-1384s1c1
Sequence:CCGGCTCCAGAGGAAAGAGAGAGAACTCGAGTTCTCTCTCTTTCCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-950s1c1
Sequence:CCGGCTCAAAGAACTATGGGAAATACTCGAGTATTTCCCATAGTTCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-877s1c1
Sequence:CCGGCAGAACCATATCATGTTGATACTCGAGTATCAACATGATATGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-877s21c1
Sequence:CCGGCAGAACCATATCATGTTGATACTCGAGTATCAACATGATATGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027192.1-992s1c1
Sequence:CCGGCTTCGAAGAGTTCAATCAGTACTCGAGTACTGATTGAACTCTTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-493s21c1
Sequence:CCGGCGTATGTGATTTATCCAACTACTCGAGTAGTTGGATAAATCACATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-934s21c1
Sequence:CCGGGCATTCAGAAAGAGTACTCAACTCGAGTTGAGTACTCTTTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027192.1-1384s21c1
Sequence:CCGGCTCCAGAGGAAAGAGAGAGAACTCGAGTTCTCTCTCTTTCCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-950s21c1
Sequence:CCGGCTCAAAGAACTATGGGAAATACTCGAGTATTTCCCATAGTTCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027192
VALIDATED
TTL MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202319    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027192.1-1445s1c1
Sequence:CCGGGCAGGAAGAGTGTGAAGAGATCTCGAGATCTCTTCACACTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-934s1c1
Sequence:CCGGGCATTCAGAAAGAGTACTCAACTCGAGTTGAGTACTCTTTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-493s1c1
Sequence:CCGGCGTATGTGATTTATCCAACTACTCGAGTAGTTGGATAAATCACATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-1384s1c1
Sequence:CCGGCTCCAGAGGAAAGAGAGAGAACTCGAGTTCTCTCTCTTTCCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-950s1c1
Sequence:CCGGCTCAAAGAACTATGGGAAATACTCGAGTATTTCCCATAGTTCTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027192.1-877s1c1
Sequence:CCGGCAGAACCATATCATGTTGATACTCGAGTATCAACATGATATGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-877s21c1
Sequence:CCGGCAGAACCATATCATGTTGATACTCGAGTATCAACATGATATGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027192.1-992s1c1
Sequence:CCGGCTTCGAAGAGTTCAATCAGTACTCGAGTACTGATTGAACTCTTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-493s21c1
Sequence:CCGGCGTATGTGATTTATCCAACTACTCGAGTAGTTGGATAAATCACATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-934s21c1
Sequence:CCGGGCATTCAGAAAGAGTACTCAACTCGAGTTGAGTACTCTTTCTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027192.1-1384s21c1
Sequence:CCGGCTCCAGAGGAAAGAGAGAGAACTCGAGTTCTCTCTCTTTCCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027192.1-950s21c1
Sequence:CCGGCTCAAAGAACTATGGGAAATACTCGAGTATTTCCCATAGTTCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153712
VALIDATED
TTL MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-306s1c1
Sequence:CCGGCCCTGAATCTTATGTGATTTACTCGAGTAAATCACATAAGATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-226s1c1
Sequence:CCGGGCTGACAAACTGTGTCGCAAACTCGAGTTTGCGACACAGTTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-844s1c1
Sequence:CCGGGCTTTGAACATTACCCTAGAACTCGAGTTCTAGGGTAATGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-528s1c1
Sequence:CCGGGCTTCTCGATTTCATAGACAACTCGAGTTGTCTATGAAATCGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-195s1c1
Sequence:CCGGGCTGGTACAGTTGGTGAATTACTCGAGTAATTCACCAACTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153712.4-757s21c1
Sequence:CCGGAGCCAGGTCATCGCAAGTTTGCTCGAGCAAACTTGCGATGACCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153712.4-566s21c1
Sequence:CCGGATTCTTTCTCGCCTCTTATAACTCGAGTTATAAGAGGCGAGAAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153712.4-858s21c1
Sequence:CCGGCCATATCATGTTGATAATTTCCTCGAGGAAATTATCAACATGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153712
VALIDATED
TTL MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-306s1c1
Sequence:CCGGCCCTGAATCTTATGTGATTTACTCGAGTAAATCACATAAGATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-226s1c1
Sequence:CCGGGCTGACAAACTGTGTCGCAAACTCGAGTTTGCGACACAGTTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-844s1c1
Sequence:CCGGGCTTTGAACATTACCCTAGAACTCGAGTTCTAGGGTAATGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-528s1c1
Sequence:CCGGGCTTCTCGATTTCATAGACAACTCGAGTTGTCTATGAAATCGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-195s1c1
Sequence:CCGGGCTGGTACAGTTGGTGAATTACTCGAGTAATTCACCAACTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153712.4-757s21c1
Sequence:CCGGAGCCAGGTCATCGCAAGTTTGCTCGAGCAAACTTGCGATGACCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153712.4-566s21c1
Sequence:CCGGATTCTTTCTCGCCTCTTATAACTCGAGTTATAAGAGGCGAGAAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153712.4-858s21c1
Sequence:CCGGCCATATCATGTTGATAATTTCCTCGAGGAAATTATCAACATGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153712
VALIDATED
TTL MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-306s1c1
Sequence:CCGGCCCTGAATCTTATGTGATTTACTCGAGTAAATCACATAAGATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-226s1c1
Sequence:CCGGGCTGACAAACTGTGTCGCAAACTCGAGTTTGCGACACAGTTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-844s1c1
Sequence:CCGGGCTTTGAACATTACCCTAGAACTCGAGTTCTAGGGTAATGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-528s1c1
Sequence:CCGGGCTTCTCGATTTCATAGACAACTCGAGTTGTCTATGAAATCGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153712.3-195s1c1
Sequence:CCGGGCTGGTACAGTTGGTGAATTACTCGAGTAATTCACCAACTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153712.4-757s21c1
Sequence:CCGGAGCCAGGTCATCGCAAGTTTGCTCGAGCAAACTTGCGATGACCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153712.4-566s21c1
Sequence:CCGGATTCTTTCTCGCCTCTTATAACTCGAGTTATAAGAGGCGAGAAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153712.4-858s21c1
Sequence:CCGGCCATATCATGTTGATAATTTCCTCGAGGAAATTATCAACATGATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks