EMAIL THIS PAGE TO A FRIEND

TTLL10

tubulin tyrosine ligase-like family, member 10

Synonyms: TTLL5
UniProtKB ID: Q6ZVT0, B1AMF6, Q5T2W4, Q5T2W5, Q8N9X2
Gene ID:
Mouse(330010) tubulin tyrosine ligase-like family, member 10
Rat(298692) tubulin tyrosine ligase-like family, member 10
cow(100336825) tubulin tyrosine ligase-like family, member 10
chicken(419426) tubulin tyrosine ligase-like family, member 10
dog(489601) tubulin tyrosine ligase-like family, member 10
Horse(100051705) tubulin tyrosine ligase-like family, member 10
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153254 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU162751 MISSION® esiRNA esiRNA targeting mouse Ttll10 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153254 Rosetta Predictions human pricing
NM_001024758 Rosetta Predictions rat pricing
NM_029264 Rosetta Predictions mouse pricing
XM_284044 Rosetta Predictions mouse pricing
XM_895076 Rosetta Predictions mouse pricing
XM_902548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185653 predicted 454
2 SASI_Hs01_00185655 predicted 1096
3 SASI_Hs01_00185656 predicted 1275
4 SASI_Hs01_00185657 predicted 455
5 SASI_Hs01_00185658 predicted 1347
6 SASI_Hs01_00185659 predicted 1650
7 SASI_Hs01_00185660 predicted 1865
8 SASI_Hs01_00185661 predicted 1627
9 SASI_Hs02_00367118 predicted 264
10 SASI_Hs02_00367119 predicted 917
11 SASI_Hs01_00185652 predicted 1642
12 SASI_Hs01_00185654 predicted 1119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114933 predicted 1669
2 SASI_Rn01_00114934 predicted 1373
3 SASI_Rn01_00114936 predicted 896
4 SASI_Rn01_00114937 predicted 1198
5 SASI_Rn01_00114938 predicted 356
6 SASI_Rn01_00114939 predicted 1336
7 SASI_Rn01_00114940 predicted 1031
8 SASI_Rn01_00114941 predicted 436
9 SASI_Rn01_00114942 predicted 1465
10 SASI_Rn02_00202637 predicted 1000
11 SASI_Rn01_00114935 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335027 predicted 396
2 SASI_Mm02_00335028 predicted 742
3 SASI_Mm02_00335029 predicted 1405
4 SASI_Mm02_00335030 predicted 1303
5 SASI_Mm02_00335031 predicted 898
6 SASI_Mm02_00335032 predicted 1486
7 SASI_Mm02_00335033 predicted 715
8 SASI_Mm02_00335034 predicted 636
9 SASI_Mm02_00335035 predicted 1320
10 SASI_Mm02_00335036 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268683 predicted 321
2 SASI_Mm01_00268684 predicted 413
3 SASI_Mm01_00268685 predicted 310
4 SASI_Mm01_00268686 predicted 310
5 SASI_Mm01_00268687 predicted 494
6 SASI_Mm01_00268688 predicted 562
7 SASI_Mm01_00268689 predicted 324
8 SASI_Mm01_00268690 predicted 314
9 SASI_Mm01_00268691 predicted 329
10 SASI_Mm01_00268692 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208962 predicted 745
2 SASI_Mm01_00208963 predicted 1411
3 SASI_Mm01_00208964 predicted 1306
4 SASI_Mm01_00208965 predicted 899
5 SASI_Mm01_00208966 predicted 1492
6 SASI_Mm01_00208967 predicted 650
7 SASI_Mm01_00208968 predicted 283
8 SASI_Mm01_00208969 predicted 756
9 SASI_Mm01_00208970 predicted 1326
10 SASI_Mm01_00208971 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251576 predicted 1751
2 SASI_Mm01_00251577 predicted 1040
3 SASI_Mm01_00251578 predicted 1750
4 SASI_Mm01_00251579 predicted 1700
5 SASI_Mm01_00251580 predicted 1650
6 SASI_Mm01_00251581 predicted 1548
7 SASI_Mm01_00251582 predicted 1729
8 SASI_Mm01_00251583 predicted 1781
9 SASI_Mm01_00251584 predicted 1687
10 SASI_Mm01_00251585 predicted 1824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153254
TTLL10 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153254.1-1203s1c1
Sequence:CCGGCCACTTGACCAACCAGTTCATCTCGAGATGAACTGGTTGGTCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153254.1-1882s1c1
Sequence:CCGGGCGGTGTGAAACTGGGATAAACTCGAGTTTATCCCAGTTTCACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153254.1-1664s1c1
Sequence:CCGGGAGTCTTTGTTCCTTTCAGATCTCGAGATCTGAAAGGAACAAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153254.1-864s1c1
Sequence:CCGGCTTGTTTGATGAAACCCAGATCTCGAGATCTGGGTTTCATCAAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153254.1-1659s1c1
Sequence:CCGGGTGAAGAGTCTTTGTTCCTTTCTCGAGAAAGGAACAAAGACTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153254.1-1275s1c1
Sequence:CCGGCATGGAACATCTCAACCGCTACTCGAGTAGCGGTTGAGATGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153254.1-458s1c1
Sequence:CCGGCCACAATCATCAGCTCCTACTCTCGAGAGTAGGAGCTGATGATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153254.2-325s21c1
Sequence:CCGGGCAGACTCGGATGACACTAACCTCGAGGTTAGTGTCATCCGAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153254.2-1788s21c1
Sequence:CCGGTGCGGTGGAGTGTCCTAATTTCTCGAGAAATTAGGACACTCCACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153254.2-533s21c1
Sequence:CCGGTGAAGTGGTGTGAGGTCAAGACTCGAGTCTTGACCTCACACCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153254
TTLL10 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153254.1-1203s1c1
Sequence:CCGGCCACTTGACCAACCAGTTCATCTCGAGATGAACTGGTTGGTCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153254.1-1882s1c1
Sequence:CCGGGCGGTGTGAAACTGGGATAAACTCGAGTTTATCCCAGTTTCACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153254.1-1664s1c1
Sequence:CCGGGAGTCTTTGTTCCTTTCAGATCTCGAGATCTGAAAGGAACAAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153254.1-864s1c1
Sequence:CCGGCTTGTTTGATGAAACCCAGATCTCGAGATCTGGGTTTCATCAAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153254.1-1659s1c1
Sequence:CCGGGTGAAGAGTCTTTGTTCCTTTCTCGAGAAAGGAACAAAGACTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153254.1-1275s1c1
Sequence:CCGGCATGGAACATCTCAACCGCTACTCGAGTAGCGGTTGAGATGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153254.1-458s1c1
Sequence:CCGGCCACAATCATCAGCTCCTACTCTCGAGAGTAGGAGCTGATGATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153254.2-325s21c1
Sequence:CCGGGCAGACTCGGATGACACTAACCTCGAGGTTAGTGTCATCCGAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153254.2-1788s21c1
Sequence:CCGGTGCGGTGGAGTGTCCTAATTTCTCGAGAAATTAGGACACTCCACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153254.2-533s21c1
Sequence:CCGGTGAAGTGGTGTGAGGTCAAGACTCGAGTCTTGACCTCACACCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153254
TTLL10 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153254.1-1203s1c1
Sequence:CCGGCCACTTGACCAACCAGTTCATCTCGAGATGAACTGGTTGGTCAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153254.1-1882s1c1
Sequence:CCGGGCGGTGTGAAACTGGGATAAACTCGAGTTTATCCCAGTTTCACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153254.1-1664s1c1
Sequence:CCGGGAGTCTTTGTTCCTTTCAGATCTCGAGATCTGAAAGGAACAAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153254.1-864s1c1
Sequence:CCGGCTTGTTTGATGAAACCCAGATCTCGAGATCTGGGTTTCATCAAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153254.1-1659s1c1
Sequence:CCGGGTGAAGAGTCTTTGTTCCTTTCTCGAGAAAGGAACAAAGACTCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153254.1-1275s1c1
Sequence:CCGGCATGGAACATCTCAACCGCTACTCGAGTAGCGGTTGAGATGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153254.1-458s1c1
Sequence:CCGGCCACAATCATCAGCTCCTACTCTCGAGAGTAGGAGCTGATGATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153254.2-325s21c1
Sequence:CCGGGCAGACTCGGATGACACTAACCTCGAGGTTAGTGTCATCCGAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153254.2-1788s21c1
Sequence:CCGGTGCGGTGGAGTGTCCTAATTTCTCGAGAAATTAGGACACTCCACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153254.2-533s21c1
Sequence:CCGGTGAAGTGGTGTGAGGTCAAGACTCGAGTCTTGACCTCACACCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029264
TTLL10 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-1213s21c1
Sequence:CCGGTGCGCTCCTACATGCTCATTGCTCGAGCAATGAGCATGTAGGAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-1413s21c1
Sequence:CCGGCGATACATCAATGACAAATTTCTCGAGAAATTTGTCATTGATGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-646s21c1
Sequence:CCGGGCACCAACGGAGCATCAATAACTCGAGTTATTGATGCTCCGTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-971s21c1
Sequence:CCGGGCAGGCTTTCTTCGCTCTATTCTCGAGAATAGAGCGAAGAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-716s21c1
Sequence:CCGGCTGTGAGGACTACAAGCTAAACTCGAGTTTAGCTTGTAGTCCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029264
TTLL10 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-1213s21c1
Sequence:CCGGTGCGCTCCTACATGCTCATTGCTCGAGCAATGAGCATGTAGGAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-1413s21c1
Sequence:CCGGCGATACATCAATGACAAATTTCTCGAGAAATTTGTCATTGATGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-646s21c1
Sequence:CCGGGCACCAACGGAGCATCAATAACTCGAGTTATTGATGCTCCGTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-971s21c1
Sequence:CCGGGCAGGCTTTCTTCGCTCTATTCTCGAGAATAGAGCGAAGAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-716s21c1
Sequence:CCGGCTGTGAGGACTACAAGCTAAACTCGAGTTTAGCTTGTAGTCCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029264
TTLL10 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-1213s21c1
Sequence:CCGGTGCGCTCCTACATGCTCATTGCTCGAGCAATGAGCATGTAGGAGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-1413s21c1
Sequence:CCGGCGATACATCAATGACAAATTTCTCGAGAAATTTGTCATTGATGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-646s21c1
Sequence:CCGGGCACCAACGGAGCATCAATAACTCGAGTTATTGATGCTCCGTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-971s21c1
Sequence:CCGGGCAGGCTTTCTTCGCTCTATTCTCGAGAATAGAGCGAAGAAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029264.2-716s21c1
Sequence:CCGGCTGTGAGGACTACAAGCTAAACTCGAGTTTAGCTTGTAGTCCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks