EMAIL THIS PAGE TO A FRIEND

TTLL11

tubulin tyrosine ligase-like family, member 11

Synonyms: C9orf20 bA244O19.1
UniProtKB ID: Q8NHH1
Gene ID:
Mouse(74410) tubulin tyrosine ligase-like family, member 11
Rat(689746) tubulin tyrosine ligase-like family, member 11
Zebrafish(558156) tubulin tyrosine ligase-like family, member 11
Horse(100071668) tubulin tyrosine ligase-like family, member 11
domestic cat(101094458) tubulin tyrosine ligase-like family, member 11
dog(491355) tubulin tyrosine ligase-like family, member 11
chicken(417115) tubulin tyrosine ligase-like family, member 11
cow(613902) tubulin tyrosine ligase-like family, member 11
sheep(101121845) tubulin tyrosine ligase-like family, member 11
domestic guinea pig(100714578) tubulin tyrosine ligase-like family, member 11
naked mole-rat(101703592) tubulin tyrosine ligase-like family, member 11
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194252 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028921 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028921 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028921 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU147711 MISSION® esiRNA esiRNA targeting mouse Ttll11 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194252 Rosetta Predictions human pricing
XM_001071863 Rosetta Predictions rat pricing
NM_028921 Rosetta Predictions mouse pricing
XM_130221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141865 predicted 945
2 SASI_Hs02_00371369 predicted 1225
3 SASI_Hs01_00141868 predicted 1346
4 SASI_Hs01_00141869 predicted 900
5 SASI_Hs01_00141870 predicted 1477
6 SASI_Hs01_00141871 predicted 1506
7 SASI_Hs01_00141872 predicted 1047
8 SASI_Hs01_00141873 predicted 1309
9 SASI_Hs02_00371370 predicted 961
10 SASI_Hs02_00371371 predicted 1122
11 SASI_Hs01_00141864 predicted 1223
12 SASI_Hs01_00141866 predicted 1233
13 SASI_Hs01_00141867 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336761 predicted 336
2 SASI_Rn02_00336762 predicted 857
3 SASI_Rn02_00336763 predicted 868
4 SASI_Rn02_00336764 predicted 336
5 SASI_Rn02_00336765 predicted 298
6 SASI_Rn02_00336766 predicted 281
7 SASI_Rn02_00336767 predicted 857
8 SASI_Rn02_00336768 predicted 1711
9 SASI_Rn02_00336769 predicted 1725
10 SASI_Rn02_00336770 predicted 1823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334609 predicted 592
2 SASI_Mm02_00334610 predicted 607
3 SASI_Mm02_00334611 predicted 707
4 SASI_Mm02_00334612 predicted 209
5 SASI_Mm02_00334613 predicted 462
6 SASI_Mm02_00334614 predicted 595
7 SASI_Mm02_00334615 predicted 428
8 SASI_Mm02_00334616 predicted 1087
9 SASI_Mm02_00334617 predicted 745
10 SASI_Mm02_00334618 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257186 predicted 605
2 SASI_Mm01_00257187 predicted 614
3 SASI_Mm01_00257188 predicted 720
4 SASI_Mm01_00257189 predicted 609
5 SASI_Mm01_00257190 predicted 1100
6 SASI_Mm01_00257191 predicted 1095
7 SASI_Mm01_00257192 predicted 1103
8 SASI_Mm01_00257193 predicted 756
9 SASI_Mm01_00257194 predicted 861
10 SASI_Mm01_00257195 predicted 757
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194252
TTLL11 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-1020s21c1
Sequence:CCGGATGACGGAGATGGTGCGTAAACTCGAGTTTACGCACCATCTCCGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-964s21c1
Sequence:CCGGGAGTTTCATTTCACGACAATGCTCGAGCATTGTCGTGAAATGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-994s21c1
Sequence:CCGGCCGGTCAAGTGAACAAGTTTCCTCGAGGAAACTTGTTCACTTGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-1623s21c1
Sequence:CCGGATCATCTCCGTGGTGATTAAGCTCGAGCTTAATCACCACGGAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194252.1-2544s1c1
Sequence:CCGGGCCTGAGAACATCGTGTTTATCTCGAGATAAACACGATGTTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194252.1-902s1c1
Sequence:CCGGGTATGTCTTACTCAAGTCCTTCTCGAGAAGGACTTGAGTAAGACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194252.1-870s1c1
Sequence:CCGGCTTATCGACAAGCTCAAGTTTCTCGAGAAACTTGAGCTTGTCGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194252.1-2545s1c1
Sequence:CCGGCCTGAGAACATCGTGTTTATTCTCGAGAATAAACACGATGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194252.1-881s1c1
Sequence:CCGGGCTCAAGTTTGATATTCGTCTCTCGAGAGACGAATATCAAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194252.1-1008s1c1
Sequence:CCGGCACCGCATCTTTATGCACTTACTCGAGTAAGTGCATAAAGATGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194252
TTLL11 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-1020s21c1
Sequence:CCGGATGACGGAGATGGTGCGTAAACTCGAGTTTACGCACCATCTCCGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-964s21c1
Sequence:CCGGGAGTTTCATTTCACGACAATGCTCGAGCATTGTCGTGAAATGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-994s21c1
Sequence:CCGGCCGGTCAAGTGAACAAGTTTCCTCGAGGAAACTTGTTCACTTGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-1623s21c1
Sequence:CCGGATCATCTCCGTGGTGATTAAGCTCGAGCTTAATCACCACGGAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194252.1-2544s1c1
Sequence:CCGGGCCTGAGAACATCGTGTTTATCTCGAGATAAACACGATGTTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194252.1-902s1c1
Sequence:CCGGGTATGTCTTACTCAAGTCCTTCTCGAGAAGGACTTGAGTAAGACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194252.1-870s1c1
Sequence:CCGGCTTATCGACAAGCTCAAGTTTCTCGAGAAACTTGAGCTTGTCGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194252.1-2545s1c1
Sequence:CCGGCCTGAGAACATCGTGTTTATTCTCGAGAATAAACACGATGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194252.1-881s1c1
Sequence:CCGGGCTCAAGTTTGATATTCGTCTCTCGAGAGACGAATATCAAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194252.1-1008s1c1
Sequence:CCGGCACCGCATCTTTATGCACTTACTCGAGTAAGTGCATAAAGATGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194252
TTLL11 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-1020s21c1
Sequence:CCGGATGACGGAGATGGTGCGTAAACTCGAGTTTACGCACCATCTCCGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-964s21c1
Sequence:CCGGGAGTTTCATTTCACGACAATGCTCGAGCATTGTCGTGAAATGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-994s21c1
Sequence:CCGGCCGGTCAAGTGAACAAGTTTCCTCGAGGAAACTTGTTCACTTGACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194252.2-1623s21c1
Sequence:CCGGATCATCTCCGTGGTGATTAAGCTCGAGCTTAATCACCACGGAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194252.1-2544s1c1
Sequence:CCGGGCCTGAGAACATCGTGTTTATCTCGAGATAAACACGATGTTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194252.1-902s1c1
Sequence:CCGGGTATGTCTTACTCAAGTCCTTCTCGAGAAGGACTTGAGTAAGACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194252.1-870s1c1
Sequence:CCGGCTTATCGACAAGCTCAAGTTTCTCGAGAAACTTGAGCTTGTCGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194252.1-2545s1c1
Sequence:CCGGCCTGAGAACATCGTGTTTATTCTCGAGAATAAACACGATGTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194252.1-881s1c1
Sequence:CCGGGCTCAAGTTTGATATTCGTCTCTCGAGAGACGAATATCAAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194252.1-1008s1c1
Sequence:CCGGCACCGCATCTTTATGCACTTACTCGAGTAAGTGCATAAAGATGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028921
TTLL11 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 11
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028921.2-2300s21c1
Sequence:CCGGGGGAATCATCAGTGGATATATCTCGAGATATATCCACTGATGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028921.2-1642s21c1
Sequence:CCGGGCCAATTTGTTCATCCGATTTCTCGAGAAATCGGATGAACAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028921.2-487s21c1
Sequence:CCGGTACTGGCATGGAGTTTCATTTCTCGAGAAATGAAACTCCATGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028921.2-912s21c1
Sequence:CCGGGGATCCCTTAGAGATTTATATCTCGAGATATAAATCTCTAAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028921
TTLL11 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 11
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028921.2-2300s21c1
Sequence:CCGGGGGAATCATCAGTGGATATATCTCGAGATATATCCACTGATGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028921.2-1642s21c1
Sequence:CCGGGCCAATTTGTTCATCCGATTTCTCGAGAAATCGGATGAACAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028921.2-487s21c1
Sequence:CCGGTACTGGCATGGAGTTTCATTTCTCGAGAAATGAAACTCCATGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028921.2-912s21c1
Sequence:CCGGGGATCCCTTAGAGATTTATATCTCGAGATATAAATCTCTAAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028921
TTLL11 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 11
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028921.2-2300s21c1
Sequence:CCGGGGGAATCATCAGTGGATATATCTCGAGATATATCCACTGATGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028921.2-1642s21c1
Sequence:CCGGGCCAATTTGTTCATCCGATTTCTCGAGAAATCGGATGAACAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028921.2-487s21c1
Sequence:CCGGTACTGGCATGGAGTTTCATTTCTCGAGAAATGAAACTCCATGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028921.2-912s21c1
Sequence:CCGGGGATCCCTTAGAGATTTATATCTCGAGATATAAATCTCTAAGGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks