EMAIL THIS PAGE TO A FRIEND

TTLL12

tubulin tyrosine ligase-like family, member 12

Synonyms: dJ526I14.2
UniProtKB ID: Q14166, Q20WK5, Q9UGU3
Gene ID:
Mouse(223723) tubulin tyrosine ligase-like family, member 12
Rat(300105) tubulin tyrosine ligase-like family, member 12
Zebrafish(393222) tubulin tyrosine ligase-like family, member 12
domestic cat(101092376) tubulin tyrosine ligase-like family, member 12
dog(474474) tubulin tyrosine ligase-like family, member 12
chicken(418227) tubulin tyrosine ligase-like family, member 12
naked mole-rat(101712240) tubulin tyrosine ligase-like family, member 12
domestic guinea pig(100726118) tubulin tyrosine ligase-like family, member 12
cow(511319) tubulin tyrosine ligase-like family, member 12
sheep(101107185) tubulin tyrosine ligase-like family, member 12
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015140 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015140 Rosetta Predictions human pricing
XM_001077932 Rosetta Predictions rat pricing
XM_235528 Rosetta Predictions rat pricing
NM_183017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080054 predicted 1479
2 SASI_Hs01_00080055 predicted 741
3 SASI_Hs01_00080056 predicted 1047
4 SASI_Hs01_00080057 predicted 1937
5 SASI_Hs01_00080058 predicted 1630
6 SASI_Hs01_00080059 predicted 2245
7 SASI_Hs01_00080060 predicted 1193
8 SASI_Hs02_00347071 predicted 2243
9 SASI_Hs02_00347072 predicted 1645
10 SASI_Hs02_00347073 predicted 234
11 SASI_Hs01_00080061 predicted 485
12 SASI_Hs01_00080062 predicted 1037
13 SASI_Hs01_00080063 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359070 predicted 1399
2 SASI_Rn02_00359071 predicted 736
3 SASI_Rn02_00359072 predicted 1726
4 SASI_Rn02_00359073 predicted 1443
5 SASI_Rn02_00359074 predicted 1010
6 SASI_Rn02_00359075 predicted 1639
7 SASI_Rn02_00359076 predicted 567
8 SASI_Rn02_00359077 predicted 1562
9 SASI_Rn02_00359078 predicted 1594
10 SASI_Rn02_00359079 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389439 predicted 602
2 SASI_Rn02_00389440 predicted 444
3 SASI_Rn02_00389441 predicted 535
4 SASI_Rn02_00389442 predicted 566
5 SASI_Rn02_00389443 predicted 479
6 SASI_Rn02_00389444 predicted 442
7 SASI_Rn02_00389445 predicted 277
8 SASI_Rn02_00389446 predicted 580
9 SASI_Rn02_00389447 predicted 555
10 SASI_Rn02_00389448 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126097 predicted 1008
2 SASI_Mm01_00126098 predicted 1400
3 SASI_Mm01_00126101 predicted 1519
4 SASI_Mm01_00126102 predicted 1298
5 SASI_Mm01_00126103 predicted 1366
6 SASI_Mm01_00126104 predicted 503
7 SASI_Mm01_00126105 predicted 1591
8 SASI_Mm01_00126106 predicted 1302
9 SASI_Mm02_00350021 predicted 816
10 SASI_Mm02_00350022 predicted 854
11 SASI_Mm01_00126099 predicted 1162
12 SASI_Mm01_00126100 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015140
VALIDATED
TTLL12 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015140.1-1527s1c1
Sequence:CCGGGAAGCACTTCACGGTCATGAACTCGAGTTCATGACCGTGAAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015140.1-438s1c1
Sequence:CCGGCAACCTGATGGGCATTGAGTTCTCGAGAACTCAATGCCCATCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015140.1-1606s1c1
Sequence:CCGGGAGAAGCAATACCCAGAATTTCTCGAGAAATTCTGGGTATTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-2826s21c1
Sequence:CCGGCAATGAGAACTTCAGGTTAAACTCGAGTTTAACCTGAAGTTCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-1906s21c1
Sequence:CCGGACGTCTTCAGCACCTTGTTTCCTCGAGGAAACAAGGTGCTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-1564s21c1
Sequence:CCGGACTTCACGGTCATGAACTATGCTCGAGCATAGTTCATGACCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015140.2-590s21c1
Sequence:CCGGGAAGATGCCGGTGTGGTATATCTCGAGATATACCACACCGGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-1477s21c1
Sequence:CCGGCCCTACGGTTGTTCGTGTATGCTCGAGCATACACGAACAACCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015140
VALIDATED
TTLL12 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015140.1-1527s1c1
Sequence:CCGGGAAGCACTTCACGGTCATGAACTCGAGTTCATGACCGTGAAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015140.1-438s1c1
Sequence:CCGGCAACCTGATGGGCATTGAGTTCTCGAGAACTCAATGCCCATCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015140.1-1606s1c1
Sequence:CCGGGAGAAGCAATACCCAGAATTTCTCGAGAAATTCTGGGTATTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-2826s21c1
Sequence:CCGGCAATGAGAACTTCAGGTTAAACTCGAGTTTAACCTGAAGTTCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-1906s21c1
Sequence:CCGGACGTCTTCAGCACCTTGTTTCCTCGAGGAAACAAGGTGCTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-1564s21c1
Sequence:CCGGACTTCACGGTCATGAACTATGCTCGAGCATAGTTCATGACCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015140.2-590s21c1
Sequence:CCGGGAAGATGCCGGTGTGGTATATCTCGAGATATACCACACCGGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-1477s21c1
Sequence:CCGGCCCTACGGTTGTTCGTGTATGCTCGAGCATACACGAACAACCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015140
VALIDATED
TTLL12 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015140.1-1527s1c1
Sequence:CCGGGAAGCACTTCACGGTCATGAACTCGAGTTCATGACCGTGAAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015140.1-438s1c1
Sequence:CCGGCAACCTGATGGGCATTGAGTTCTCGAGAACTCAATGCCCATCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015140.1-1606s1c1
Sequence:CCGGGAGAAGCAATACCCAGAATTTCTCGAGAAATTCTGGGTATTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-2826s21c1
Sequence:CCGGCAATGAGAACTTCAGGTTAAACTCGAGTTTAACCTGAAGTTCTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-1906s21c1
Sequence:CCGGACGTCTTCAGCACCTTGTTTCCTCGAGGAAACAAGGTGCTGAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-1564s21c1
Sequence:CCGGACTTCACGGTCATGAACTATGCTCGAGCATAGTTCATGACCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015140.2-590s21c1
Sequence:CCGGGAAGATGCCGGTGTGGTATATCTCGAGATATACCACACCGGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015140.2-1477s21c1
Sequence:CCGGCCCTACGGTTGTTCGTGTATGCTCGAGCATACACGAACAACCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183017
VALIDATED
TTLL12 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183017.1-195s1c1
Sequence:CCGGGTTTGGGATAAAGCAGGTGGACTCGAGTCCACCTGCTTTATCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183017.1-1857s1c1
Sequence:CCGGCTCATTCTTCAATGATGTCTTCTCGAGAAGACATCATTGAAGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-1502s21c1
Sequence:CCGGTCGATGACCTAGACGACTATGCTCGAGCATAGTCGTCTAGGTCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-1295s21c1
Sequence:CCGGACAACCTCCACAGTATCATTCCTCGAGGAATGATACTGTGGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-2065s21c1
Sequence:CCGGCAGAGCCTTGGCCTAAGTTATCTCGAGATAACTTAGGCCAAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-1564s21c1
Sequence:CCGGCTGAAGCAGGTGCACTATAATCTCGAGATTATAGTGCACCTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183017.1-569s21c1
Sequence:CCGGGGTACATCATGGACGAGTTTGCTCGAGCAAACTCGTCCATGATGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183017
VALIDATED
TTLL12 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183017.1-195s1c1
Sequence:CCGGGTTTGGGATAAAGCAGGTGGACTCGAGTCCACCTGCTTTATCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183017.1-1857s1c1
Sequence:CCGGCTCATTCTTCAATGATGTCTTCTCGAGAAGACATCATTGAAGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-1502s21c1
Sequence:CCGGTCGATGACCTAGACGACTATGCTCGAGCATAGTCGTCTAGGTCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-1295s21c1
Sequence:CCGGACAACCTCCACAGTATCATTCCTCGAGGAATGATACTGTGGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-2065s21c1
Sequence:CCGGCAGAGCCTTGGCCTAAGTTATCTCGAGATAACTTAGGCCAAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-1564s21c1
Sequence:CCGGCTGAAGCAGGTGCACTATAATCTCGAGATTATAGTGCACCTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183017.1-569s21c1
Sequence:CCGGGGTACATCATGGACGAGTTTGCTCGAGCAAACTCGTCCATGATGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183017
VALIDATED
TTLL12 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183017.1-195s1c1
Sequence:CCGGGTTTGGGATAAAGCAGGTGGACTCGAGTCCACCTGCTTTATCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183017.1-1857s1c1
Sequence:CCGGCTCATTCTTCAATGATGTCTTCTCGAGAAGACATCATTGAAGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-1502s21c1
Sequence:CCGGTCGATGACCTAGACGACTATGCTCGAGCATAGTCGTCTAGGTCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-1295s21c1
Sequence:CCGGACAACCTCCACAGTATCATTCCTCGAGGAATGATACTGTGGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-2065s21c1
Sequence:CCGGCAGAGCCTTGGCCTAAGTTATCTCGAGATAACTTAGGCCAAGGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183017.1-1564s21c1
Sequence:CCGGCTGAAGCAGGTGCACTATAATCTCGAGATTATAGTGCACCTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183017.1-569s21c1
Sequence:CCGGGGTACATCATGGACGAGTTTGCTCGAGCAAACTCGTCCATGATGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks