EMAIL THIS PAGE TO A FRIEND

TTLL13

tubulin tyrosine ligase-like family, member 13

UniProtKB ID: A6NNM8
Gene ID:
Mouse(269954) tubulin tyrosine ligase-like family, member 13
Rat(308762) tubulin tyrosine ligase-like family, member 13
domestic guinea pig(100726136) tubulin tyrosine ligase-like family, member 13
naked mole-rat(101712056) tubulin tyrosine ligase-like family, member 13
Horse(100053576) tubulin tyrosine ligase-like family, member 13
dog(479047) tubulin tyrosine ligase-like family, member 13
domestic cat(101081807) tubulin tyrosine ligase-like family, member 13
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001029964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029964 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224831 MISSION® esiRNA esiRNA targeting human TTLL13 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029964 Rosetta Predictions human pricing
NM_001134962 Rosetta Predictions rat pricing
XR_006329 Rosetta Predictions rat pricing
XR_008304 Rosetta Predictions rat pricing
NM_177765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010091 predicted 775
2 SASI_Hs01_00010092 predicted 313
3 SASI_Hs01_00010093 predicted 956
4 SASI_Hs01_00010094 predicted 1008
5 SASI_Hs01_00010095 predicted 872
6 SASI_Hs01_00010096 predicted 997
7 SASI_Hs01_00010097 predicted 1154
8 SASI_Hs01_00010099 predicted 1100
9 SASI_Hs01_00010100 predicted 1258
10 SASI_Hs02_00307580 predicted 1305
11 SASI_Hs01_00010098 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259124 predicted 2280
2 SASI_Rn02_00259125 predicted 799
3 SASI_Rn02_00259126 predicted 723
4 SASI_Rn02_00259127 predicted 2441
5 SASI_Rn02_00259128 predicted 2114
6 SASI_Rn02_00259129 predicted 1480
7 SASI_Rn02_00259130 predicted 2640
8 SASI_Rn02_00259131 predicted 2934
9 SASI_Rn02_00259132 predicted 2386
10 SASI_Rn02_00259133 predicted 2567
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191726 predicted 588
2 SASI_Rn01_00191727 predicted 821
3 SASI_Rn01_00191728 predicted 711
4 SASI_Rn01_00191729 predicted 718
5 SASI_Rn01_00191730 predicted 1081
6 SASI_Rn01_00191731 predicted 672
7 SASI_Rn01_00191732 predicted 875
8 SASI_Rn01_00191733 predicted 1054
9 SASI_Rn01_00191734 predicted 570
10 SASI_Rn01_00191735 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135985 predicted 810
2 SASI_Rn01_00135986 predicted 1047
3 SASI_Rn01_00135987 predicted 622
4 SASI_Rn01_00135988 predicted 541
5 SASI_Rn01_00135989 predicted 947
6 SASI_Rn01_00135990 predicted 356
7 SASI_Rn01_00135991 predicted 422
8 SASI_Rn01_00135992 predicted 670
9 SASI_Rn01_00135993 predicted 347
10 SASI_Rn01_00135994 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067416 predicted 1118
2 SASI_Mm02_00348145 predicted 305
3 SASI_Mm01_00067419 predicted 2467
4 SASI_Mm01_00067422 predicted 2334
5 SASI_Mm02_00348146 predicted 426
6 SASI_Mm01_00067423 predicted 2570
7 SASI_Mm02_00348147 predicted 455
8 SASI_Mm01_00067424 predicted 2753
9 SASI_Mm01_00067425 predicted 1019
10 SASI_Mm02_00348148 predicted 2217
11 SASI_Mm01_00067417 predicted 2171
12 SASI_Mm01_00067418 predicted 1014
13 SASI_Mm01_00067420 predicted 747
14 SASI_Mm01_00067421 predicted 1028
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177765
TTLL13 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 13
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177765.3-2575s21c1
Sequence:CCGGTAATTGAAAGACTGCCAACAACTCGAGTTGTTGGCAGTCTTTCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177765.3-2815s21c1
Sequence:CCGGGGTCACTGGGCAACAAGGAATCTCGAGATTCCTTGTTGCCCAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177765.2-2748s1c1
Sequence:CCGGCCAAGCCTTAGGCTGAGTTTACTCGAGTAAACTCAGCCTAAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-2550s1c1
Sequence:CCGGCAGCAAATGGTCTTCAATCTTCTCGAGAAGATTGAAGACCATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-1763s1c1
Sequence:CCGGGCACCTTTCTTCAAGCACAATCTCGAGATTGTGCTTGAAGAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-1073s1c1
Sequence:CCGGCGGATCTTCATGTACGAGGAACTCGAGTTCCTCGTACATGAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-2404s1c1
Sequence:CCGGGCCCAAGAACTTCAACTGGATCTCGAGATCCAGTTGAAGTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177765
TTLL13 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 13
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177765.3-2575s21c1
Sequence:CCGGTAATTGAAAGACTGCCAACAACTCGAGTTGTTGGCAGTCTTTCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177765.3-2815s21c1
Sequence:CCGGGGTCACTGGGCAACAAGGAATCTCGAGATTCCTTGTTGCCCAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177765.2-2748s1c1
Sequence:CCGGCCAAGCCTTAGGCTGAGTTTACTCGAGTAAACTCAGCCTAAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-2550s1c1
Sequence:CCGGCAGCAAATGGTCTTCAATCTTCTCGAGAAGATTGAAGACCATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-1763s1c1
Sequence:CCGGGCACCTTTCTTCAAGCACAATCTCGAGATTGTGCTTGAAGAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-1073s1c1
Sequence:CCGGCGGATCTTCATGTACGAGGAACTCGAGTTCCTCGTACATGAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-2404s1c1
Sequence:CCGGGCCCAAGAACTTCAACTGGATCTCGAGATCCAGTTGAAGTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177765
TTLL13 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 13
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177765.3-2575s21c1
Sequence:CCGGTAATTGAAAGACTGCCAACAACTCGAGTTGTTGGCAGTCTTTCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177765.3-2815s21c1
Sequence:CCGGGGTCACTGGGCAACAAGGAATCTCGAGATTCCTTGTTGCCCAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177765.2-2748s1c1
Sequence:CCGGCCAAGCCTTAGGCTGAGTTTACTCGAGTAAACTCAGCCTAAGGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-2550s1c1
Sequence:CCGGCAGCAAATGGTCTTCAATCTTCTCGAGAAGATTGAAGACCATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-1763s1c1
Sequence:CCGGGCACCTTTCTTCAAGCACAATCTCGAGATTGTGCTTGAAGAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-1073s1c1
Sequence:CCGGCGGATCTTCATGTACGAGGAACTCGAGTTCCTCGTACATGAAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177765.2-2404s1c1
Sequence:CCGGGCCCAAGAACTTCAACTGGATCTCGAGATCCAGTTGAAGTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029964
TTLL13 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 13
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-1341s1c1
Sequence:CCGGCCACAACTACCGAACCTGTTTCTCGAGAAACAGGTTCGGTAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-1014s1c1
Sequence:CCGGCAAGTTTGATATGCGAGTCTACTCGAGTAGACTCGCATATCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-1498s1c1
Sequence:CCGGCAAGAAGTAAAGGATGCACTTCTCGAGAAGTGCATCCTTTACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-322s1c1
Sequence:CCGGGAGGAAGACTATGTTGAGGAACTCGAGTTCCTCAACATAGTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029964
TTLL13 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 13
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-1341s1c1
Sequence:CCGGCCACAACTACCGAACCTGTTTCTCGAGAAACAGGTTCGGTAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-1014s1c1
Sequence:CCGGCAAGTTTGATATGCGAGTCTACTCGAGTAGACTCGCATATCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-1498s1c1
Sequence:CCGGCAAGAAGTAAAGGATGCACTTCTCGAGAAGTGCATCCTTTACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-322s1c1
Sequence:CCGGGAGGAAGACTATGTTGAGGAACTCGAGTTCCTCAACATAGTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029964
TTLL13 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 13
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-1341s1c1
Sequence:CCGGCCACAACTACCGAACCTGTTTCTCGAGAAACAGGTTCGGTAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-1014s1c1
Sequence:CCGGCAAGTTTGATATGCGAGTCTACTCGAGTAGACTCGCATATCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-1498s1c1
Sequence:CCGGCAAGAAGTAAAGGATGCACTTCTCGAGAAGTGCATCCTTTACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029964.2-322s1c1
Sequence:CCGGGAGGAAGACTATGTTGAGGAACTCGAGTTCCTCAACATAGTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks