EMAIL THIS PAGE TO A FRIEND

TTLL1

tubulin tyrosine ligase-like family, member 1

Synonyms: C22orf7 HS323M22B
UniProtKB ID: O95922, B2RDS7, Q9BR27, Q9NRS9, Q9UMU0
Gene ID:
Mouse(319953) tubulin tyrosine ligase-like 1
Rat(362969) tubulin tyrosine ligase-like family, member 1
Zebrafish(393994) tubulin tyrosine ligase-like family, member 1
dog(481221) tubulin tyrosine ligase-like family, member 1
domestic cat(101086406) tubulin tyrosine ligase-like family, member 1
chicken(418225) tubulin tyrosine ligase-like family, member 1
cow(539530) tubulin tyrosine ligase-like family, member 1
sheep(101116134) tubulin tyrosine ligase-like family, member 1
domestic guinea pig(100721988) tubulin tyrosine ligase-like family, member 1
naked mole-rat(101717967) tubulin tyrosine ligase-like family, member 1
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012263 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008572 Rosetta Predictions human pricing
NM_012263 Rosetta Predictions human pricing
NM_001012200 Rosetta Predictions rat pricing
XM_576320 Rosetta Predictions rat pricing
NM_178869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207354 predicted 1235
2 SASI_Hs02_00305510 predicted 1315
3 SASI_Hs01_00207355 predicted 626
4 SASI_Hs01_00207356 predicted 642
5 SASI_Hs01_00207357 predicted 988
6 SASI_Hs01_00207358 predicted 1406
7 SASI_Hs02_00305511 predicted 813
8 SASI_Hs01_00207361 predicted 1432
9 SASI_Hs01_00207362 predicted 882
10 SASI_Hs01_00207363 predicted 1332
11 SASI_Hs01_00207359 predicted 1125
12 SASI_Hs01_00207360 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245872 predicted 1172
2 SASI_Hs02_00343984 predicted 1246
3 SASI_Hs01_00245873 predicted 554
4 SASI_Hs01_00245874 predicted 571
5 SASI_Hs01_00245875 predicted 921
6 SASI_Hs01_00245876 predicted 1330
7 SASI_Hs02_00343985 predicted 740
8 SASI_Hs01_00245879 predicted 1354
9 SASI_Hs01_00245880 predicted 807
10 SASI_Hs01_00245881 predicted 1253
11 SASI_Hs01_00245877 predicted 1059
12 SASI_Hs01_00245878 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048031 predicted 830
2 SASI_Rn01_00048032 predicted 1304
3 SASI_Rn01_00048033 predicted 1110
4 SASI_Rn01_00048035 predicted 560
5 SASI_Rn01_00048036 predicted 284
6 SASI_Rn01_00048038 predicted 1035
7 SASI_Rn01_00048039 predicted 845
8 SASI_Rn01_00048040 predicted 1279
9 SASI_Rn02_00200427 predicted 927
10 SASI_Rn02_00200428 predicted 1093
11 SASI_Rn01_00048034 predicted 559
12 SASI_Rn01_00048037 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165196 predicted 930
2 SASI_Rn01_00165197 predicted 1214
3 SASI_Rn01_00165198 predicted 645
4 SASI_Rn01_00165199 predicted 656
5 SASI_Rn01_00165200 predicted 384
6 SASI_Rn01_00165201 predicted 886
7 SASI_Rn01_00165202 predicted 1134
8 SASI_Rn01_00165203 predicted 947
9 SASI_Rn01_00165204 predicted 1265
10 SASI_Rn01_00165205 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349444 predicted 416
2 SASI_Mm02_00349445 predicted 1244
3 SASI_Mm02_00349446 predicted 1504
4 SASI_Mm02_00349447 predicted 964
5 SASI_Mm02_00349448 predicted 1161
6 SASI_Mm02_00349449 predicted 888
7 SASI_Mm02_00349450 predicted 1298
8 SASI_Mm02_00349451 predicted 1272
9 SASI_Mm02_00349452 predicted 1409
10 SASI_Mm02_00349453 predicted 1223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012263
TTLL1 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012263.4-1013s21c1
Sequence:CCGGGGCAAGTGGACAGTGAGTAACCTCGAGGTTACTCACTGTCCACTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-757s1c1
Sequence:CCGGGCCTACGTGATCTCTCTCTATCTCGAGATAGAGAGAGATCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-885s1c1
Sequence:CCGGCCGGTTCTGCACAGTGAAATACTCGAGTATTTCACTGTGCAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-1119s1c1
Sequence:CCGGGCCGGTGATGAACAATGACAACTCGAGTTGTCATTGTTCATCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-391s1c1
Sequence:CCGGCGGCTCTCAGATGACCAAATACTCGAGTATTTGGTCATCTGAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-1254s1c1
Sequence:CCGGCCTCAAGTACAACCTGATTAACTCGAGTTAATCAGGTTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012263
TTLL1 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012263.4-1013s21c1
Sequence:CCGGGGCAAGTGGACAGTGAGTAACCTCGAGGTTACTCACTGTCCACTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-757s1c1
Sequence:CCGGGCCTACGTGATCTCTCTCTATCTCGAGATAGAGAGAGATCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-885s1c1
Sequence:CCGGCCGGTTCTGCACAGTGAAATACTCGAGTATTTCACTGTGCAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-1119s1c1
Sequence:CCGGGCCGGTGATGAACAATGACAACTCGAGTTGTCATTGTTCATCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-391s1c1
Sequence:CCGGCGGCTCTCAGATGACCAAATACTCGAGTATTTGGTCATCTGAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-1254s1c1
Sequence:CCGGCCTCAAGTACAACCTGATTAACTCGAGTTAATCAGGTTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012263
TTLL1 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012263.4-1013s21c1
Sequence:CCGGGGCAAGTGGACAGTGAGTAACCTCGAGGTTACTCACTGTCCACTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-757s1c1
Sequence:CCGGGCCTACGTGATCTCTCTCTATCTCGAGATAGAGAGAGATCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-885s1c1
Sequence:CCGGCCGGTTCTGCACAGTGAAATACTCGAGTATTTCACTGTGCAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-1119s1c1
Sequence:CCGGGCCGGTGATGAACAATGACAACTCGAGTTGTCATTGTTCATCACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-391s1c1
Sequence:CCGGCGGCTCTCAGATGACCAAATACTCGAGTATTTGGTCATCTGAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012263.2-1254s1c1
Sequence:CCGGCCTCAAGTACAACCTGATTAACTCGAGTTAATCAGGTTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178869
VALIDATED
TTLL1 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178869.4-1279s21c1
Sequence:CCGGCCAGTGATGAACAACGACAAACTCGAGTTTGTCGTTGTTCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-918s21c1
Sequence:CCGGGTACGTGATCTCAGTCTATATCTCGAGATATAGACTGAGATCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-1714s21c1
Sequence:CCGGGTCCCTGCTAAACACCCGTTTCTCGAGAAACGGGTGTTTAGCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-1414s21c1
Sequence:CCGGCTTAAGTACAACCTGATTAACCTCGAGGTTAATCAGGTTGTACTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-1903s21c1
Sequence:CCGGACAACAGCTTCGGTATGTGATCTCGAGATCACATACCGAAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178869.2-1742s1c1
Sequence:CCGGGCCTTGTAAATAAAGACTCAACTCGAGTTGAGTCTTTATTTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-1250s1c1
Sequence:CCGGCCAGTGATGAACAACGACAAACTCGAGTTTGTCGTTGTTCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-889s1c1
Sequence:CCGGGTACGTGATCTCAGTCTATATCTCGAGATATAGACTGAGATCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-481s1c1
Sequence:CCGGGCAAACCATTCGCAACGTGTTCTCGAGAACACGTTGCGAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-887s1c1
Sequence:CCGGGCGTACGTGATCTCAGTCTATCTCGAGATAGACTGAGATCACGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178869
VALIDATED
TTLL1 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178869.4-1279s21c1
Sequence:CCGGCCAGTGATGAACAACGACAAACTCGAGTTTGTCGTTGTTCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-918s21c1
Sequence:CCGGGTACGTGATCTCAGTCTATATCTCGAGATATAGACTGAGATCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-1714s21c1
Sequence:CCGGGTCCCTGCTAAACACCCGTTTCTCGAGAAACGGGTGTTTAGCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-1414s21c1
Sequence:CCGGCTTAAGTACAACCTGATTAACCTCGAGGTTAATCAGGTTGTACTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-1903s21c1
Sequence:CCGGACAACAGCTTCGGTATGTGATCTCGAGATCACATACCGAAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178869.2-1742s1c1
Sequence:CCGGGCCTTGTAAATAAAGACTCAACTCGAGTTGAGTCTTTATTTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-1250s1c1
Sequence:CCGGCCAGTGATGAACAACGACAAACTCGAGTTTGTCGTTGTTCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-889s1c1
Sequence:CCGGGTACGTGATCTCAGTCTATATCTCGAGATATAGACTGAGATCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-481s1c1
Sequence:CCGGGCAAACCATTCGCAACGTGTTCTCGAGAACACGTTGCGAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-887s1c1
Sequence:CCGGGCGTACGTGATCTCAGTCTATCTCGAGATAGACTGAGATCACGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178869
VALIDATED
TTLL1 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178869.4-1279s21c1
Sequence:CCGGCCAGTGATGAACAACGACAAACTCGAGTTTGTCGTTGTTCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-918s21c1
Sequence:CCGGGTACGTGATCTCAGTCTATATCTCGAGATATAGACTGAGATCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-1714s21c1
Sequence:CCGGGTCCCTGCTAAACACCCGTTTCTCGAGAAACGGGTGTTTAGCAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-1414s21c1
Sequence:CCGGCTTAAGTACAACCTGATTAACCTCGAGGTTAATCAGGTTGTACTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178869.4-1903s21c1
Sequence:CCGGACAACAGCTTCGGTATGTGATCTCGAGATCACATACCGAAGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178869.2-1742s1c1
Sequence:CCGGGCCTTGTAAATAAAGACTCAACTCGAGTTGAGTCTTTATTTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-1250s1c1
Sequence:CCGGCCAGTGATGAACAACGACAAACTCGAGTTTGTCGTTGTTCATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-889s1c1
Sequence:CCGGGTACGTGATCTCAGTCTATATCTCGAGATATAGACTGAGATCACGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-481s1c1
Sequence:CCGGGCAAACCATTCGCAACGTGTTCTCGAGAACACGTTGCGAATGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178869.2-887s1c1
Sequence:CCGGGCGTACGTGATCTCAGTCTATCTCGAGATAGACTGAGATCACGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks