EMAIL THIS PAGE TO A FRIEND

TTLL2

tubulin tyrosine ligase-like family, member 2

Synonyms: C6orf104 NYD-TSPG dJ366N23.3
UniProtKB ID: Q9BWV7, B2RB11, B3KS77, Q7Z6R8, Q86X22
Gene ID:
Mouse(100216474) tubulin tyrosine ligase-like family, member 2
Rat(292311) tubulin tyrosine ligase-like family, member 2
Zebrafish(799958) tubulin tyrosine ligase-like family, member 2
chicken(421566) tubulin tyrosine ligase-like family, member 2
dog(476269) tubulin tyrosine ligase-like family, member 2
domestic cat(101080892) tubulin tyrosine ligase-like family, member 2
naked mole-rat(101723045) tubulin tyrosine ligase-like family, member 2
cow(519714) tubulin tyrosine ligase-like family, member 2
sheep(101114784) tubulin tyrosine ligase-like family, member 2
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031949 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119051 MISSION® esiRNA esiRNA human TTLL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031949 Rosetta Predictions human pricing
XM_001070106 Rosetta Predictions rat pricing
XM_217869 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205069 predicted 1029
2 SASI_Hs01_00205071 predicted 1554
3 SASI_Hs01_00205072 predicted 1848
4 SASI_Hs01_00205073 predicted 1362
5 SASI_Hs01_00205074 predicted 1273
6 SASI_Hs01_00205075 predicted 1327
7 SASI_Hs01_00205076 predicted 1269
8 SASI_Hs01_00205077 predicted 852
9 SASI_Hs02_00359115 predicted 824
10 SASI_Hs02_00359116 predicted 469
11 SASI_Hs01_00205068 predicted 880
12 SASI_Hs01_00205070 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330460 predicted 640
2 SASI_Rn02_00330461 predicted 1232
3 SASI_Rn02_00330462 predicted 568
4 SASI_Rn02_00330463 predicted 1160
5 SASI_Rn02_00330464 predicted 565
6 SASI_Rn02_00330465 predicted 472
7 SASI_Rn02_00330466 predicted 567
8 SASI_Rn02_00330467 predicted 1131
9 SASI_Rn02_00330468 predicted 564
10 SASI_Rn02_00330469 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377387 predicted 640
2 SASI_Rn02_00377388 predicted 1228
3 SASI_Rn02_00377389 predicted 572
4 SASI_Rn02_00377390 predicted 1151
5 SASI_Rn02_00377391 predicted 560
6 SASI_Rn02_00377392 predicted 473
7 SASI_Rn02_00377393 predicted 575
8 SASI_Rn02_00377394 predicted 1129
9 SASI_Rn02_00377395 predicted 568
10 SASI_Rn02_00377396 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031949
TTLL2 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-997s1c1
Sequence:CCGGGCCTCTTATGAGAAGATCAAACTCGAGTTTGATCTTCTCATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-289s1c1
Sequence:CCGGCCTCATTTGATGGCGGAAGATCTCGAGATCTTCCGCCATCAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-1302s1c1
Sequence:CCGGCCATGATATTATTGACCTGATCTCGAGATCAGGTCAATAATATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-814s1c1
Sequence:CCGGCCTTTACTTATTGGCAGATATCTCGAGATATCTGCCAATAAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-1591s1c1
Sequence:CCGGCCACAAAGCAAGCCCAAGTTACTCGAGTAACTTGGGCTTGCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031949.4-2142s21c1
Sequence:CCGGATGTGCTACACTACGATTATGCTCGAGCATAATCGTAGTGTAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031949.4-882s21c1
Sequence:CCGGTTAAGCCTTTGACCATTTATGCTCGAGCATAAATGGTCAAAGGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031949.4-1031s21c1
Sequence:CCGGGTGATTGGTCATGGTTGTAAACTCGAGTTTACAACCATGACCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031949
TTLL2 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-997s1c1
Sequence:CCGGGCCTCTTATGAGAAGATCAAACTCGAGTTTGATCTTCTCATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-289s1c1
Sequence:CCGGCCTCATTTGATGGCGGAAGATCTCGAGATCTTCCGCCATCAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-1302s1c1
Sequence:CCGGCCATGATATTATTGACCTGATCTCGAGATCAGGTCAATAATATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-814s1c1
Sequence:CCGGCCTTTACTTATTGGCAGATATCTCGAGATATCTGCCAATAAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-1591s1c1
Sequence:CCGGCCACAAAGCAAGCCCAAGTTACTCGAGTAACTTGGGCTTGCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031949.4-2142s21c1
Sequence:CCGGATGTGCTACACTACGATTATGCTCGAGCATAATCGTAGTGTAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031949.4-882s21c1
Sequence:CCGGTTAAGCCTTTGACCATTTATGCTCGAGCATAAATGGTCAAAGGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031949.4-1031s21c1
Sequence:CCGGGTGATTGGTCATGGTTGTAAACTCGAGTTTACAACCATGACCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031949
TTLL2 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-997s1c1
Sequence:CCGGGCCTCTTATGAGAAGATCAAACTCGAGTTTGATCTTCTCATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-289s1c1
Sequence:CCGGCCTCATTTGATGGCGGAAGATCTCGAGATCTTCCGCCATCAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-1302s1c1
Sequence:CCGGCCATGATATTATTGACCTGATCTCGAGATCAGGTCAATAATATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-814s1c1
Sequence:CCGGCCTTTACTTATTGGCAGATATCTCGAGATATCTGCCAATAAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031949.3-1591s1c1
Sequence:CCGGCCACAAAGCAAGCCCAAGTTACTCGAGTAACTTGGGCTTGCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031949.4-2142s21c1
Sequence:CCGGATGTGCTACACTACGATTATGCTCGAGCATAATCGTAGTGTAGCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031949.4-882s21c1
Sequence:CCGGTTAAGCCTTTGACCATTTATGCTCGAGCATAAATGGTCAAAGGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031949.4-1031s21c1
Sequence:CCGGGTGATTGGTCATGGTTGTAAACTCGAGTTTACAACCATGACCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks