EMAIL THIS PAGE TO A FRIEND

TTLL3

tubulin tyrosine ligase-like family, member 3

Synonyms: HOTTL
Gene ID:
Mouse(101100) tubulin tyrosine ligase-like family, member 3
Rat(362415) tubulin tyrosine ligase-like family, member 3
cow(531866) tubulin tyrosine ligase-like family, member 3
domestic guinea pig(100730882) tubulin tyrosine ligase-like family, member 3
naked mole-rat(101698131) tubulin tyrosine ligase-like family, member 3
Zebrafish(724000) tubulin tyrosine ligase-like family, member 3
chicken(416052) tubulin tyrosine ligase-like family, member 3
domestic cat(101091352) tubulin tyrosine ligase-like family, member 3
dog(484664) tubulin tyrosine ligase-like family, member 3
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015644 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025930 Rosetta Predictions human pricing
NM_015644 Rosetta Predictions human pricing
NM_001108640 Rosetta Predictions rat pricing
NM_133923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307489 predicted 479
2 SASI_Hs02_00307490 predicted 698
3 SASI_Hs02_00307491 predicted 1253
4 SASI_Hs02_00307492 predicted 1269
5 SASI_Hs02_00307493 predicted 545
6 SASI_Hs02_00307494 predicted 1460
7 SASI_Hs02_00307495 predicted 1340
8 SASI_Hs02_00307496 predicted 2204
9 SASI_Hs02_00307497 predicted 1559
10 SASI_Hs02_00307498 predicted 1372
11 SASI_Hs01_00018094 predicted 1793
12 SASI_Hs01_00018095 predicted 1752
13 SASI_Hs01_00018096 predicted 808
14 SASI_Hs01_00018097 predicted 1650
15 SASI_Hs01_00018098 predicted 1659
16 SASI_Hs01_00018099 predicted 1781
17 SASI_Hs01_00018100 predicted 1755
18 SASI_Hs01_00018101 predicted 1842
19 SASI_Hs01_00018102 predicted 810
20 SASI_Hs01_00018103 predicted 1694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033159 predicted 3814
2 SASI_Hs01_00033160 predicted 3785
3 SASI_Hs01_00033161 predicted 2982
4 SASI_Hs01_00033162 predicted 3673
5 SASI_Hs01_00033163 predicted 3692
6 SASI_Hs01_00033164 predicted 3808
7 SASI_Hs01_00033165 predicted 3781
8 SASI_Hs01_00033166 predicted 3870
9 SASI_Hs01_00033167 predicted 2977
10 SASI_Hs01_00033168 predicted 3726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240619 predicted 711
2 SASI_Rn02_00240620 predicted 696
3 SASI_Rn02_00240621 predicted 228
4 SASI_Rn02_00240622 predicted 718
5 SASI_Rn02_00240623 predicted 703
6 SASI_Rn02_00240624 predicted 220
7 SASI_Rn02_00240625 predicted 491
8 SASI_Rn02_00240626 predicted 208
9 SASI_Rn02_00240627 predicted 340
10 SASI_Rn02_00240628 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121668 predicted 1505
2 SASI_Mm01_00121669 predicted 723
3 SASI_Mm01_00121670 predicted 986
4 SASI_Mm01_00121671 predicted 2288
5 SASI_Mm01_00121672 predicted 2218
6 SASI_Mm01_00121673 predicted 1201
7 SASI_Mm01_00121674 predicted 349
8 SASI_Mm01_00121675 predicted 696
9 SASI_Mm01_00121676 predicted 967
10 SASI_Mm01_00121677 predicted 2286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133923
TTLL3 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-488s21c1
Sequence:CCGGTCAAGCAGAAGAAGATCTTTACTCGAGTAAAGATCTTCTTCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133923.6-2808s21c1
Sequence:CCGGTTTACGCCGAGGCTGCTATTCCTCGAGGAATAGCAGCCTCGGCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-757s21c1
Sequence:CCGGATGTCCCGCATGGTTCGAAATCTCGAGATTTCGAACCATGCGGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-1278s21c1
Sequence:CCGGCCTTCAGCGCTACTACCAAATCTCGAGATTTGGTAGTAGCGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-114s21c1
Sequence:CCGGATCCGAGCTCCGCACCAATTTCTCGAGAAATTGGTGCGGAGCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133923.2-866s1c1
Sequence:CCGGGATGACAAGAAAGCCTTCATACTCGAGTATGAAGGCTTTCTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191085    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133923.2-1239s1c1
Sequence:CCGGCCAAACCTGAGATGGAATTTACTCGAGTAAATTCCATCTCAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133923.2-1160s1c1
Sequence:CCGGCAAAGTAAGTTCCTGTTTCAACTCGAGTTGAAACAGGAACTTACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133923
TTLL3 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-488s21c1
Sequence:CCGGTCAAGCAGAAGAAGATCTTTACTCGAGTAAAGATCTTCTTCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133923.6-2808s21c1
Sequence:CCGGTTTACGCCGAGGCTGCTATTCCTCGAGGAATAGCAGCCTCGGCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-757s21c1
Sequence:CCGGATGTCCCGCATGGTTCGAAATCTCGAGATTTCGAACCATGCGGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-1278s21c1
Sequence:CCGGCCTTCAGCGCTACTACCAAATCTCGAGATTTGGTAGTAGCGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-114s21c1
Sequence:CCGGATCCGAGCTCCGCACCAATTTCTCGAGAAATTGGTGCGGAGCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133923.2-866s1c1
Sequence:CCGGGATGACAAGAAAGCCTTCATACTCGAGTATGAAGGCTTTCTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191085    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133923.2-1239s1c1
Sequence:CCGGCCAAACCTGAGATGGAATTTACTCGAGTAAATTCCATCTCAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133923.2-1160s1c1
Sequence:CCGGCAAAGTAAGTTCCTGTTTCAACTCGAGTTGAAACAGGAACTTACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133923
TTLL3 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-488s21c1
Sequence:CCGGTCAAGCAGAAGAAGATCTTTACTCGAGTAAAGATCTTCTTCTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133923.6-2808s21c1
Sequence:CCGGTTTACGCCGAGGCTGCTATTCCTCGAGGAATAGCAGCCTCGGCGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-757s21c1
Sequence:CCGGATGTCCCGCATGGTTCGAAATCTCGAGATTTCGAACCATGCGGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-1278s21c1
Sequence:CCGGCCTTCAGCGCTACTACCAAATCTCGAGATTTGGTAGTAGCGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133923.6-114s21c1
Sequence:CCGGATCCGAGCTCCGCACCAATTTCTCGAGAAATTGGTGCGGAGCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133923.2-866s1c1
Sequence:CCGGGATGACAAGAAAGCCTTCATACTCGAGTATGAAGGCTTTCTTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191085    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133923.2-1239s1c1
Sequence:CCGGCCAAACCTGAGATGGAATTTACTCGAGTAAATTCCATCTCAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133923.2-1160s1c1
Sequence:CCGGCAAAGTAAGTTCCTGTTTCAACTCGAGTTGAAACAGGAACTTACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015644
TTLL3 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1083s1c1
Sequence:CCGGTCGCAACATCTGGATCGTGAACTCGAGTTCACGATCCAGATGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1503s1c1
Sequence:CCGGCCCAAATGCTTGGTCCACCATCTCGAGATGGTGGACCAAGCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1784s1c1
Sequence:CCGGGAGCCTTTGAGCTCATCTATACTCGAGTATAGATGAGCTCAAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1318s1c1
Sequence:CCGGCGCGACAGCTATATCCGCTTTCTCGAGAAAGCGGATATAGCTGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1282s1c1
Sequence:CCGGGTAACTGACTGGAACCCACTTCTCGAGAAGTGGGTTCCAGTCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015644
TTLL3 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1083s1c1
Sequence:CCGGTCGCAACATCTGGATCGTGAACTCGAGTTCACGATCCAGATGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1503s1c1
Sequence:CCGGCCCAAATGCTTGGTCCACCATCTCGAGATGGTGGACCAAGCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1784s1c1
Sequence:CCGGGAGCCTTTGAGCTCATCTATACTCGAGTATAGATGAGCTCAAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1318s1c1
Sequence:CCGGCGCGACAGCTATATCCGCTTTCTCGAGAAAGCGGATATAGCTGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1282s1c1
Sequence:CCGGGTAACTGACTGGAACCCACTTCTCGAGAAGTGGGTTCCAGTCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015644
TTLL3 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1083s1c1
Sequence:CCGGTCGCAACATCTGGATCGTGAACTCGAGTTCACGATCCAGATGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1503s1c1
Sequence:CCGGCCCAAATGCTTGGTCCACCATCTCGAGATGGTGGACCAAGCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1784s1c1
Sequence:CCGGGAGCCTTTGAGCTCATCTATACTCGAGTATAGATGAGCTCAAAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1318s1c1
Sequence:CCGGCGCGACAGCTATATCCGCTTTCTCGAGAAAGCGGATATAGCTGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015644.1-1282s1c1
Sequence:CCGGGTAACTGACTGGAACCCACTTCTCGAGAAGTGGGTTCCAGTCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks