EMAIL THIS PAGE TO A FRIEND

TTLL4

tubulin tyrosine ligase-like family, member 4

UniProtKB ID: Q14679, A8K6V5, Q8WW29
Gene ID:
Mouse(67534) tubulin tyrosine ligase-like family, member 4
Rat(690512) tubulin tyrosine ligase-like family, member 4
Zebrafish(558702) tubulin tyrosine ligase-like family, member 4
Horse(100055898) tubulin tyrosine ligase-like family, member 4
domestic cat(101099141) tubulin tyrosine ligase-like family, member 4
dog(488525) tubulin tyrosine ligase-like family, member 4
chicken(424209) tubulin tyrosine ligase-like family, member 4
naked mole-rat(101700742) tubulin tyrosine ligase-like family, member 4
domestic guinea pig(100725277) tubulin tyrosine ligase-like family, member 4
cow(511853) tubulin tyrosine ligase-like family, member 4
sheep(101112884) tubulin tyrosine ligase-like family, member 4
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001014974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001014974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014640 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131261 MISSION® esiRNA esiRNA human TTLL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014640 Rosetta Predictions human pricing
XM_001074653 Rosetta Predictions rat pricing
NM_001014974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178385 predicted 1750
2 SASI_Hs01_00178386 predicted 2219
3 SASI_Hs01_00178387 predicted 2967
4 SASI_Hs01_00178388 predicted 2144
5 SASI_Hs01_00178389 predicted 2571
6 SASI_Hs01_00178390 predicted 1281
7 SASI_Hs01_00178391 predicted 2936
8 SASI_Hs01_00178392 predicted 3639
9 SASI_Hs01_00178393 predicted 2681
10 SASI_Hs01_00178394 predicted 3774
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346915 predicted 2041
2 SASI_Rn02_00346916 predicted 824
3 SASI_Rn02_00346917 predicted 384
4 SASI_Rn02_00346918 predicted 1656
5 SASI_Rn02_00346919 predicted 1486
6 SASI_Rn02_00346920 predicted 808
7 SASI_Rn02_00346921 predicted 1059
8 SASI_Rn02_00346922 predicted 2817
9 SASI_Rn02_00346923 predicted 973
10 SASI_Rn02_00346924 predicted 1781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066418 predicted 3209
2 SASI_Mm01_00066419 predicted 2068
3 SASI_Mm01_00066420 predicted 3512
4 SASI_Mm01_00066422 predicted 1450
5 SASI_Mm01_00066423 predicted 782
6 SASI_Mm02_00287449 predicted 3797
7 SASI_Mm01_00066424 predicted 1373
8 SASI_Mm01_00066425 predicted 716
9 SASI_Mm01_00066426 predicted 864
10 SASI_Mm01_00066427 predicted 2839
11 SASI_Mm01_00066421 predicted 2942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014974
VALIDATED
TTLL4 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-3449s1c1
Sequence:CCGGCGTGGTCAATTTGAAAGAATTCTCGAGAATTCTTTCAAATTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-2311s1c1
Sequence:CCGGCCACATGAAGTCTCCTGGTTTCTCGAGAAACCAGGAGACTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-3589s1c1
Sequence:CCGGGCTTCGGAATTGGTGCTACAACTCGAGTTGTAGCACCAATTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-4082s1c1
Sequence:CCGGGAAGTGGTTCTATTGTAGATACTCGAGTATCTACAATAGAACCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-1453s1c1
Sequence:CCGGCCAGTTTGAACAGGCTTGTTTCTCGAGAAACAAGCCTGTTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014974
VALIDATED
TTLL4 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-3449s1c1
Sequence:CCGGCGTGGTCAATTTGAAAGAATTCTCGAGAATTCTTTCAAATTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-2311s1c1
Sequence:CCGGCCACATGAAGTCTCCTGGTTTCTCGAGAAACCAGGAGACTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-3589s1c1
Sequence:CCGGGCTTCGGAATTGGTGCTACAACTCGAGTTGTAGCACCAATTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-4082s1c1
Sequence:CCGGGAAGTGGTTCTATTGTAGATACTCGAGTATCTACAATAGAACCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-1453s1c1
Sequence:CCGGCCAGTTTGAACAGGCTTGTTTCTCGAGAAACAAGCCTGTTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014974
VALIDATED
TTLL4 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-3449s1c1
Sequence:CCGGCGTGGTCAATTTGAAAGAATTCTCGAGAATTCTTTCAAATTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-2311s1c1
Sequence:CCGGCCACATGAAGTCTCCTGGTTTCTCGAGAAACCAGGAGACTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-3589s1c1
Sequence:CCGGGCTTCGGAATTGGTGCTACAACTCGAGTTGTAGCACCAATTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-4082s1c1
Sequence:CCGGGAAGTGGTTCTATTGTAGATACTCGAGTATCTACAATAGAACCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001014974.1-1453s1c1
Sequence:CCGGCCAGTTTGAACAGGCTTGTTTCTCGAGAAACAAGCCTGTTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014640
TTLL4 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-3239s1c1
Sequence:CCGGGCCTATTATCTGACCCAGAAACTCGAGTTTCTGGGTCAGATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-2224s1c1
Sequence:CCGGCCACATGAAGTCTCCTAGTTTCTCGAGAAACTAGGAGACTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-2015s1c1
Sequence:CCGGGCCCTCATCTACAGTCTCTTTCTCGAGAAAGAGACTGTAGATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-3353s1c1
Sequence:CCGGCGTGGTCAGTTTGAACGAATTCTCGAGAATTCGTTCAAACTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-1439s1c1
Sequence:CCGGCCTGCGGTAAATCAGCAGTTTCTCGAGAAACTGCTGATTTACCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014640.4-3485s21c1
Sequence:CCGGTTTGAGCAGCCACGATATTTCCTCGAGGAAATATCGTGGCTGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014640.4-3189s21c1
Sequence:CCGGCCAATGCAGAGGATATCATTTCTCGAGAAATGATATCCTCTGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014640.4-2689s21c1
Sequence:CCGACTACGATCCTCTGCGGATTTACTCGAGTAAATCCGCAGAGGATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014640
TTLL4 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-3239s1c1
Sequence:CCGGGCCTATTATCTGACCCAGAAACTCGAGTTTCTGGGTCAGATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-2224s1c1
Sequence:CCGGCCACATGAAGTCTCCTAGTTTCTCGAGAAACTAGGAGACTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-2015s1c1
Sequence:CCGGGCCCTCATCTACAGTCTCTTTCTCGAGAAAGAGACTGTAGATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-3353s1c1
Sequence:CCGGCGTGGTCAGTTTGAACGAATTCTCGAGAATTCGTTCAAACTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-1439s1c1
Sequence:CCGGCCTGCGGTAAATCAGCAGTTTCTCGAGAAACTGCTGATTTACCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014640.4-3485s21c1
Sequence:CCGGTTTGAGCAGCCACGATATTTCCTCGAGGAAATATCGTGGCTGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014640.4-3189s21c1
Sequence:CCGGCCAATGCAGAGGATATCATTTCTCGAGAAATGATATCCTCTGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014640.4-2689s21c1
Sequence:CCGACTACGATCCTCTGCGGATTTACTCGAGTAAATCCGCAGAGGATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014640
TTLL4 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-3239s1c1
Sequence:CCGGGCCTATTATCTGACCCAGAAACTCGAGTTTCTGGGTCAGATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-2224s1c1
Sequence:CCGGCCACATGAAGTCTCCTAGTTTCTCGAGAAACTAGGAGACTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-2015s1c1
Sequence:CCGGGCCCTCATCTACAGTCTCTTTCTCGAGAAAGAGACTGTAGATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-3353s1c1
Sequence:CCGGCGTGGTCAGTTTGAACGAATTCTCGAGAATTCGTTCAAACTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014640.2-1439s1c1
Sequence:CCGGCCTGCGGTAAATCAGCAGTTTCTCGAGAAACTGCTGATTTACCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014640.4-3485s21c1
Sequence:CCGGTTTGAGCAGCCACGATATTTCCTCGAGGAAATATCGTGGCTGCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014640.4-3189s21c1
Sequence:CCGGCCAATGCAGAGGATATCATTTCTCGAGAAATGATATCCTCTGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014640.4-2689s21c1
Sequence:CCGACTACGATCCTCTGCGGATTTACTCGAGTAAATCCGCAGAGGATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks