EMAIL THIS PAGE TO A FRIEND

TTLL5

tubulin tyrosine ligase-like family, member 5

Synonyms: KIAA0998 STAMP
Gene ID:
Human(23093) Summary: This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
Mouse(320244) tubulin tyrosine ligase-like family, member 5
cow(538422) tubulin tyrosine ligase-like family, member 5
sheep(101110944) tubulin tyrosine ligase-like family, member 5
domestic guinea pig(100714683) tubulin tyrosine ligase-like family, member 5
naked mole-rat(101713873) tubulin tyrosine ligase-like family, member 5
chicken(423367) tubulin tyrosine ligase-like family, member 5
dog(480394) tubulin tyrosine ligase-like family, member 5
domestic cat(101084291) tubulin tyrosine ligase-like family, member 5
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097051 MISSION® esiRNA esiRNA human TTLL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015072 Rosetta Predictions human pricing
NM_001081423 Rosetta Predictions mouse pricing
XM_988689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168438 predicted 3157
2 SASI_Hs02_00346933 predicted 3244
3 SASI_Hs01_00168439 predicted 428
4 SASI_Hs01_00168440 predicted 3746
5 SASI_Hs01_00168441 predicted 2247
6 SASI_Hs01_00168442 predicted 966
7 SASI_Hs01_00168443 predicted 1698
8 SASI_Hs02_00346934 predicted 2789
9 SASI_Hs01_00168444 predicted 899
10 SASI_Hs01_00168446 predicted 1643
11 SASI_Hs01_00168445 predicted 1005
12 SASI_Hs01_00168447 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298241 predicted 1214
2 SASI_Mm02_00298242 predicted 3083
3 SASI_Mm02_00298243 predicted 2526
4 SASI_Mm02_00298244 predicted 1302
5 SASI_Mm02_00298245 predicted 2007
6 SASI_Mm02_00298246 predicted 3099
7 SASI_Mm02_00298247 predicted 1221
8 SASI_Mm02_00298248 predicted 3877
9 SASI_Mm02_00298249 predicted 532
10 SASI_Mm02_00298250 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259678 predicted 1217
2 SASI_Mm01_00259679 predicted 3083
3 SASI_Mm01_00259680 predicted 658
4 SASI_Mm01_00259681 predicted 2533
5 SASI_Mm01_00259682 predicted 1301
6 SASI_Mm01_00259683 predicted 1291
7 SASI_Mm01_00259684 predicted 3098
8 SASI_Mm01_00259685 predicted 1695
9 SASI_Mm01_00259686 predicted 3211
10 SASI_Mm01_00259687 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015072
VALIDATED
TTLL5 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 5
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015072.3-2344s21c1
Sequence:CCGGGCTGGTTGTTCGTTTCCTCAACTCGAGTTGAGGAAACGAACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_015072.3-2939s21c1
Sequence:CCGGCCTTGCCACCATTCTTCTTTACTCGAGTAAAGAAGAATGGTGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015072.3-4285s21c1
Sequence:CCGGCATTCAGCTGATGCATTATATCTCGAGATATAATGCATCAGCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015072.3-1162s21c1
Sequence:CCGGCCTGATCATTAAGACTATAATCTCGAGATTATAGTCTTAATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015072.3-3633s21c1
Sequence:CCGGCAGGCAGCTATCAGCTTCAATCTCGAGATTGAAGCTGATAGCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015072.2-2151s1c1
Sequence:CCGGCAGGCAGCTATCAGCTTCAATCTCGAGATTGAAGCTGATAGCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015072.2-2289s1c1
Sequence:CCGGCAATGAATAATGGTGCAGGTTCTCGAGAACCTGCACCATTATTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015072.2-778s1c1
Sequence:CCGGGCATGTTCAAATTCGCCTGATCTCGAGATCAGGCGAATTTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015072.2-181s1c1
Sequence:CCGGCGAGCATAAGACCTCAATGAACTCGAGTTCATTGAGGTCTTATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015072.2-1243s1c1
Sequence:CCGGCCCTGAGACTATAATGGAAGACTCGAGTCTTCCATTATAGTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015072.2-1457s1c1
Sequence:CCGGCCTTGCCACCATTCTTCTTTACTCGAGTAAAGAAGAATGGTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015072.2-119s1c1
Sequence:CCGGCGAGGTGGATTTATTCGCATACTCGAGTATGCGAATAAATCCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015072.2-862s1c1
Sequence:CCGGGCTGGTTGTTCGTTTCCTCAACTCGAGTTGAGGAAACGAACAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015072.2-143s1c1
Sequence:CCGGCCTACATCTGAGACATGGGAACTCGAGTTCCCATGTCTCAGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015072.2-751s1c1
Sequence:CCGGCCGAATAGCATTCTCTGCCTACTCGAGTAGGCAGAGAATGCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015072
VALIDATED
TTLL5 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 5
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015072.3-2344s21c1
Sequence:CCGGGCTGGTTGTTCGTTTCCTCAACTCGAGTTGAGGAAACGAACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_015072.3-2939s21c1
Sequence:CCGGCCTTGCCACCATTCTTCTTTACTCGAGTAAAGAAGAATGGTGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015072.3-4285s21c1
Sequence:CCGGCATTCAGCTGATGCATTATATCTCGAGATATAATGCATCAGCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015072.3-1162s21c1
Sequence:CCGGCCTGATCATTAAGACTATAATCTCGAGATTATAGTCTTAATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015072.3-3633s21c1
Sequence:CCGGCAGGCAGCTATCAGCTTCAATCTCGAGATTGAAGCTGATAGCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015072.2-2151s1c1
Sequence:CCGGCAGGCAGCTATCAGCTTCAATCTCGAGATTGAAGCTGATAGCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015072.2-2289s1c1
Sequence:CCGGCAATGAATAATGGTGCAGGTTCTCGAGAACCTGCACCATTATTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015072.2-778s1c1
Sequence:CCGGGCATGTTCAAATTCGCCTGATCTCGAGATCAGGCGAATTTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015072.2-181s1c1
Sequence:CCGGCGAGCATAAGACCTCAATGAACTCGAGTTCATTGAGGTCTTATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015072.2-1243s1c1
Sequence:CCGGCCCTGAGACTATAATGGAAGACTCGAGTCTTCCATTATAGTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015072.2-1457s1c1
Sequence:CCGGCCTTGCCACCATTCTTCTTTACTCGAGTAAAGAAGAATGGTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015072.2-119s1c1
Sequence:CCGGCGAGGTGGATTTATTCGCATACTCGAGTATGCGAATAAATCCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015072.2-862s1c1
Sequence:CCGGGCTGGTTGTTCGTTTCCTCAACTCGAGTTGAGGAAACGAACAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015072.2-143s1c1
Sequence:CCGGCCTACATCTGAGACATGGGAACTCGAGTTCCCATGTCTCAGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015072.2-751s1c1
Sequence:CCGGCCGAATAGCATTCTCTGCCTACTCGAGTAGGCAGAGAATGCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015072
VALIDATED
TTLL5 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 5
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_015072.3-2344s21c1
Sequence:CCGGGCTGGTTGTTCGTTTCCTCAACTCGAGTTGAGGAAACGAACAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_015072.3-2939s21c1
Sequence:CCGGCCTTGCCACCATTCTTCTTTACTCGAGTAAAGAAGAATGGTGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015072.3-4285s21c1
Sequence:CCGGCATTCAGCTGATGCATTATATCTCGAGATATAATGCATCAGCTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015072.3-1162s21c1
Sequence:CCGGCCTGATCATTAAGACTATAATCTCGAGATTATAGTCTTAATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015072.3-3633s21c1
Sequence:CCGGCAGGCAGCTATCAGCTTCAATCTCGAGATTGAAGCTGATAGCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015072.2-2151s1c1
Sequence:CCGGCAGGCAGCTATCAGCTTCAATCTCGAGATTGAAGCTGATAGCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015072.2-2289s1c1
Sequence:CCGGCAATGAATAATGGTGCAGGTTCTCGAGAACCTGCACCATTATTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015072.2-778s1c1
Sequence:CCGGGCATGTTCAAATTCGCCTGATCTCGAGATCAGGCGAATTTGAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015072.2-181s1c1
Sequence:CCGGCGAGCATAAGACCTCAATGAACTCGAGTTCATTGAGGTCTTATGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015072.2-1243s1c1
Sequence:CCGGCCCTGAGACTATAATGGAAGACTCGAGTCTTCCATTATAGTCTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015072.2-1457s1c1
Sequence:CCGGCCTTGCCACCATTCTTCTTTACTCGAGTAAAGAAGAATGGTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_015072.2-119s1c1
Sequence:CCGGCGAGGTGGATTTATTCGCATACTCGAGTATGCGAATAAATCCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015072.2-862s1c1
Sequence:CCGGGCTGGTTGTTCGTTTCCTCAACTCGAGTTGAGGAAACGAACAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015072.2-143s1c1
Sequence:CCGGCCTACATCTGAGACATGGGAACTCGAGTTCCCATGTCTCAGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_015072.2-751s1c1
Sequence:CCGGCCGAATAGCATTCTCTGCCTACTCGAGTAGGCAGAGAATGCTATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081423
TTLL5 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-1688s21c1
Sequence:CCGGCGGACATCCAACCGGTCAATTCTCGAGAATTGACCGGTTGGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-2422s21c1
Sequence:CCGGAGTTGCCGAGTGGACTAATAACTCGAGTTATTAGTCCACTCGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-994s21c1
Sequence:CCGGCCGAGGACCTTGGATAGTAAACTCGAGTTTACTATCCAAGGTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-746s21c1
Sequence:CCGGCCGAGCAGCACTGACTATAATCTCGAGATTATAGTCAGTGCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081423.1-4901s21c1
Sequence:CCGGGCTGCTCACAGATGGTATAAACTCGAGTTTATACCATCTGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081423
TTLL5 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-1688s21c1
Sequence:CCGGCGGACATCCAACCGGTCAATTCTCGAGAATTGACCGGTTGGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-2422s21c1
Sequence:CCGGAGTTGCCGAGTGGACTAATAACTCGAGTTATTAGTCCACTCGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-994s21c1
Sequence:CCGGCCGAGGACCTTGGATAGTAAACTCGAGTTTACTATCCAAGGTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-746s21c1
Sequence:CCGGCCGAGCAGCACTGACTATAATCTCGAGATTATAGTCAGTGCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081423.1-4901s21c1
Sequence:CCGGGCTGCTCACAGATGGTATAAACTCGAGTTTATACCATCTGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081423
TTLL5 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-1688s21c1
Sequence:CCGGCGGACATCCAACCGGTCAATTCTCGAGAATTGACCGGTTGGATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-2422s21c1
Sequence:CCGGAGTTGCCGAGTGGACTAATAACTCGAGTTATTAGTCCACTCGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-994s21c1
Sequence:CCGGCCGAGGACCTTGGATAGTAAACTCGAGTTTACTATCCAAGGTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081423.1-746s21c1
Sequence:CCGGCCGAGCAGCACTGACTATAATCTCGAGATTATAGTCAGTGCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081423.1-4901s21c1
Sequence:CCGGGCTGCTCACAGATGGTATAAACTCGAGTTTATACCATCTGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks