EMAIL THIS PAGE TO A FRIEND

TTLL6

tubulin tyrosine ligase-like family, member 6

Synonyms: TTL.6
Gene ID:
Mouse(237930) tubulin tyrosine ligase-like family, member 6
Rat(287646) tubulin tyrosine ligase-like family, member 6
Zebrafish(564075) tubulin tyrosine ligase-like family, member 6
domestic cat(101081093) tubulin tyrosine ligase-like family, member 6
dog(480544) tubulin tyrosine ligase-like family, member 6
naked mole-rat(101715040) tubulin tyrosine ligase-like family, member 6
domestic guinea pig(100719402) tubulin tyrosine ligase-like family, member 6
cow(526482) tubulin tyrosine ligase-like family, member 6
sheep(101120098) tubulin tyrosine ligase-like family, member 6
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173623 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172799 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172799 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172799 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173623 Rosetta Predictions human pricing
XM_001081334 Rosetta Predictions rat pricing
XM_220904 Rosetta Predictions rat pricing
NM_172799 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026752 predicted 1846
2 SASI_Hs01_00026753 predicted 428
3 SASI_Hs01_00026754 predicted 1410
4 SASI_Hs01_00026755 predicted 886
5 SASI_Hs01_00026757 predicted 601
6 SASI_Hs01_00026758 predicted 876
7 SASI_Hs02_00368501 predicted 892
8 SASI_Hs01_00026759 predicted 1392
9 SASI_Hs01_00026760 predicted 918
10 SASI_Hs01_00026761 predicted 387
11 SASI_Hs01_00026756 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371479 predicted 627
2 SASI_Rn02_00371480 predicted 775
3 SASI_Rn02_00371481 predicted 1168
4 SASI_Rn02_00371482 predicted 1150
5 SASI_Rn02_00371483 predicted 890
6 SASI_Rn02_00371484 predicted 1651
7 SASI_Rn02_00371485 predicted 1756
8 SASI_Rn02_00371486 predicted 1928
9 SASI_Rn02_00371487 predicted 1985
10 SASI_Rn02_00371488 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379639 predicted 625
2 SASI_Rn02_00379640 predicted 778
3 SASI_Rn02_00379641 predicted 1170
4 SASI_Rn02_00379642 predicted 1146
5 SASI_Rn02_00379643 predicted 896
6 SASI_Rn02_00379644 predicted 1650
7 SASI_Rn02_00379645 predicted 1748
8 SASI_Rn02_00379646 predicted 1923
9 SASI_Rn02_00379647 predicted 1976
10 SASI_Rn02_00379648 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172799 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187128 predicted 2490
2 SASI_Mm01_00187129 predicted 1507
3 SASI_Mm01_00187130 predicted 1102
4 SASI_Mm01_00187131 predicted 2977
5 SASI_Mm01_00187132 predicted 2822
6 SASI_Mm01_00187133 predicted 2803
7 SASI_Mm01_00187134 predicted 1510
8 SASI_Mm01_00187135 predicted 2817
9 SASI_Mm01_00187137 predicted 2646
10 SASI_Mm02_00344715 predicted 2381
11 SASI_Mm01_00187136 predicted 2609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173623
TTLL6 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173623.1-894s1c1
Sequence:CCGGGCCATTGACATTAGTATCCTACTCGAGTAGGATACTAATGTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173623.1-879s1c1
Sequence:CCGGCAAACAGTACATCCAGCCATTCTCGAGAATGGCTGGATGTACTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173623.1-435s1c1
Sequence:CCGGCAACCTGGAAAGCTGTGACAACTCGAGTTGTCACAGCTTTCCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173623.1-2299s1c1
Sequence:CCGGGCTGCAACTTCACAAGGTCAACTCGAGTTGACCTTGTGAAGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173623.1-1931s1c1
Sequence:CCGGGTCTTCCATTAGTTCCTAGTACTCGAGTACTAGGAACTAATGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173623.3-1276s21c1
Sequence:CCGGCGGACAGGGTGGTATCCTTTACTCGAGTAAAGGATACCACCCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173623.3-592s21c1
Sequence:CCGGGTGGAGGGTTCCGACTGATTTCTCGAGAAATCAGTCGGAACCCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173623
TTLL6 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173623.1-894s1c1
Sequence:CCGGGCCATTGACATTAGTATCCTACTCGAGTAGGATACTAATGTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173623.1-879s1c1
Sequence:CCGGCAAACAGTACATCCAGCCATTCTCGAGAATGGCTGGATGTACTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173623.1-435s1c1
Sequence:CCGGCAACCTGGAAAGCTGTGACAACTCGAGTTGTCACAGCTTTCCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173623.1-2299s1c1
Sequence:CCGGGCTGCAACTTCACAAGGTCAACTCGAGTTGACCTTGTGAAGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173623.1-1931s1c1
Sequence:CCGGGTCTTCCATTAGTTCCTAGTACTCGAGTACTAGGAACTAATGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173623.3-1276s21c1
Sequence:CCGGCGGACAGGGTGGTATCCTTTACTCGAGTAAAGGATACCACCCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173623.3-592s21c1
Sequence:CCGGGTGGAGGGTTCCGACTGATTTCTCGAGAAATCAGTCGGAACCCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173623
TTLL6 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173623.1-894s1c1
Sequence:CCGGGCCATTGACATTAGTATCCTACTCGAGTAGGATACTAATGTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173623.1-879s1c1
Sequence:CCGGCAAACAGTACATCCAGCCATTCTCGAGAATGGCTGGATGTACTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173623.1-435s1c1
Sequence:CCGGCAACCTGGAAAGCTGTGACAACTCGAGTTGTCACAGCTTTCCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173623.1-2299s1c1
Sequence:CCGGGCTGCAACTTCACAAGGTCAACTCGAGTTGACCTTGTGAAGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173623.1-1931s1c1
Sequence:CCGGGTCTTCCATTAGTTCCTAGTACTCGAGTACTAGGAACTAATGGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173623.3-1276s21c1
Sequence:CCGGCGGACAGGGTGGTATCCTTTACTCGAGTAAAGGATACCACCCTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173623.3-592s21c1
Sequence:CCGGGTGGAGGGTTCCGACTGATTTCTCGAGAAATCAGTCGGAACCCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172799
TTLL6 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172799.1-3087s1c1
Sequence:CCGGCCCGGAGTTAAGCAACTTGAACTCGAGTTCAAGTTGCTTAACTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-2385s1c1
Sequence:CCGGCCATAACGTCTGTAGAAAGTTCTCGAGAACTTTCTACAGACGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-1762s1c1
Sequence:CCGGCCAGGCCATGAGGTTACAGAACTCGAGTTCTGTAACCTCATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-1523s1c1
Sequence:CCGGGACATCTTGTTGGACCGGAAACTCGAGTTTCCGGTCCAACAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-1235s1c1
Sequence:CCGGCCTAACCTAGACAACCTGGATCTCGAGATCCAGGTTGTCTAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172799
TTLL6 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172799.1-3087s1c1
Sequence:CCGGCCCGGAGTTAAGCAACTTGAACTCGAGTTCAAGTTGCTTAACTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-2385s1c1
Sequence:CCGGCCATAACGTCTGTAGAAAGTTCTCGAGAACTTTCTACAGACGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-1762s1c1
Sequence:CCGGCCAGGCCATGAGGTTACAGAACTCGAGTTCTGTAACCTCATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-1523s1c1
Sequence:CCGGGACATCTTGTTGGACCGGAAACTCGAGTTTCCGGTCCAACAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-1235s1c1
Sequence:CCGGCCTAACCTAGACAACCTGGATCTCGAGATCCAGGTTGTCTAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172799
TTLL6 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172799.1-3087s1c1
Sequence:CCGGCCCGGAGTTAAGCAACTTGAACTCGAGTTCAAGTTGCTTAACTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-2385s1c1
Sequence:CCGGCCATAACGTCTGTAGAAAGTTCTCGAGAACTTTCTACAGACGTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-1762s1c1
Sequence:CCGGCCAGGCCATGAGGTTACAGAACTCGAGTTCTGTAACCTCATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-1523s1c1
Sequence:CCGGGACATCTTGTTGGACCGGAAACTCGAGTTTCCGGTCCAACAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172799.1-1235s1c1
Sequence:CCGGCCTAACCTAGACAACCTGGATCTCGAGATCCAGGTTGTCTAGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks