EMAIL THIS PAGE TO A FRIEND

TTLL7

tubulin tyrosine ligase-like family, member 7

Synonyms: RP5-836J3.2
UniProtKB ID: Q6ZT98, Q5TAX8, Q5TAX9, Q6P990, Q86YS1, Q9H5U4
Gene ID:
Mouse(70892) tubulin tyrosine ligase-like family, member 7
Rat(310982) tubulin tyrosine ligase-like family, member 7
cow(522221) tubulin tyrosine ligase-like family, member 7
sheep(101108264) tubulin tyrosine ligase-like family, member 7
domestic guinea pig(100712966) tubulin tyrosine ligase-like family, member 7
naked mole-rat(101722842) tubulin tyrosine ligase-like family, member 7
Domestic Rabbit(100342462) tubulin tyrosine ligase-like family, member 7
Zebrafish(565243) tubulin tyrosine ligase-like family, member 7
chicken(424543) tubulin tyrosine ligase-like family, member 7
Horse(100052881) tubulin tyrosine ligase-like family, member 7
domestic cat(101090956) tubulin tyrosine ligase-like family, member 7
dog(479976) tubulin tyrosine ligase-like family, member 7
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024686 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024686 Rosetta Predictions human pricing
XM_001077354 Rosetta Predictions rat pricing
XM_001077391 Rosetta Predictions rat pricing
XM_227828 Rosetta Predictions rat pricing
XM_001005472 Rosetta Predictions mouse pricing
XM_001005473 Rosetta Predictions mouse pricing
XM_991015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140961 predicted 593
2 SASI_Hs02_00357126 predicted 2505
3 SASI_Hs01_00140962 predicted 1104
4 SASI_Hs01_00140963 predicted 1857
5 SASI_Hs01_00140964 predicted 1122
6 SASI_Hs01_00140966 predicted 2526
7 SASI_Hs02_00357127 predicted 620
8 SASI_Hs02_00357128 predicted 711
9 SASI_Hs01_00140969 predicted 1132
10 SASI_Hs01_00140970 predicted 1100
11 SASI_Hs01_00140965 predicted 981
12 SASI_Hs01_00140967 predicted 1623
13 SASI_Hs01_00140968 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356760 predicted 1253
2 SASI_Rn02_00356761 predicted 2201
3 SASI_Rn02_00356762 predicted 1186
4 SASI_Rn02_00356763 predicted 1245
5 SASI_Rn02_00356764 predicted 2567
6 SASI_Rn02_00356765 predicted 2186
7 SASI_Rn02_00356766 predicted 758
8 SASI_Rn02_00356767 predicted 1045
9 SASI_Rn02_00356768 predicted 1164
10 SASI_Rn02_00356769 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356901 predicted 1199
2 SASI_Rn02_00356902 predicted 2156
3 SASI_Rn02_00356903 predicted 1137
4 SASI_Rn02_00356904 predicted 1192
5 SASI_Rn02_00356905 predicted 2518
6 SASI_Rn02_00356906 predicted 2128
7 SASI_Rn02_00356907 predicted 707
8 SASI_Rn02_00356908 predicted 994
9 SASI_Rn02_00356909 predicted 1117
10 SASI_Rn02_00356910 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384761 predicted 1215
2 SASI_Rn02_00384762 predicted 2163
3 SASI_Rn02_00384763 predicted 1148
4 SASI_Rn02_00384764 predicted 1407
5 SASI_Rn02_00384765 predicted 1308
6 SASI_Rn02_00384766 predicted 1196
7 SASI_Rn02_00384767 predicted 2521
8 SASI_Rn02_00384768 predicted 2140
9 SASI_Rn02_00384769 predicted 2009
10 SASI_Rn02_00384770 predicted 2273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222389 predicted 1139
2 SASI_Mm01_00222390 predicted 1404
3 SASI_Mm01_00222391 predicted 1217
4 SASI_Mm01_00222392 predicted 983
5 SASI_Mm01_00222393 predicted 1160
6 SASI_Mm01_00222394 predicted 522
7 SASI_Mm01_00222395 predicted 720
8 SASI_Mm01_00222396 predicted 459
9 SASI_Mm01_00222397 predicted 1123
10 SASI_Mm01_00222398 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262915 predicted 1095
2 SASI_Mm01_00262916 predicted 1170
3 SASI_Mm01_00262918 predicted 1113
4 SASI_Mm01_00262919 predicted 2506
5 SASI_Mm01_00262920 predicted 484
6 SASI_Mm01_00262921 predicted 667
7 SASI_Mm02_00356483 predicted 2645
8 SASI_Mm01_00262922 predicted 414
9 SASI_Mm01_00262923 predicted 1083
10 SASI_Mm01_00262924 predicted 1220
11 SASI_Mm01_00262917 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450534 predicted 1095
2 SASI_Mm02_00450535 predicted 1168
3 SASI_Mm02_00450536 predicted 1112
4 SASI_Mm02_00450537 predicted 2500
5 SASI_Mm02_00450538 predicted 482
6 SASI_Mm02_00450539 predicted 674
7 SASI_Mm02_00450540 predicted 2648
8 SASI_Mm02_00450541 predicted 418
9 SASI_Mm02_00450542 predicted 1084
10 SASI_Mm02_00450543 predicted 1215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024686
VALIDATED
TTLL7 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024686.4-760s21c1
Sequence:CCGGCCTCTGGATTATACCTTTGTTCTCGAGAACAAAGGTATAATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024686.4-2434s21c1
Sequence:CCGGCTAACAAGTCAGACCTTATTTCTCGAGAAATAAGGTCTGACTTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024686.4-3335s21c1
Sequence:CCGGTCTAGAATCTGCTAGGTTTATCTCGAGATAAACCTAGCAGATTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024686.4-1074s21c1
Sequence:CCGGGCGAATGGGTACAGAGAAGTACTCGAGTACTTCTCTGTACCCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024686.4-1750s21c1
Sequence:CCGGGGGAATTATAGACGAATTTATCTCGAGATAAATTCGTCTATAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024686.3-1196s1c1
Sequence:CCGGCCATCAAATGGTTTACAGAATCTCGAGATTCTGTAAACCATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024686.3-922s1c1
Sequence:CCGGCAGGATCATTTGATTGTTCAACTCGAGTTGAACAATCAAATGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-742s1c1
Sequence:CCGGCCTCTGGATTATACCTTTGTTCTCGAGAACAAAGGTATAATCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-1756s1c1
Sequence:CCGGCCTGAAGATAAAGCATTACTTCTCGAGAAGTAATGCTTTATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-1056s1c1
Sequence:CCGGGCGAATGGGTACAGAGAAGTACTCGAGTACTTCTCTGTACCCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-1092s1c1
Sequence:CCGGGTCCAATTTGACCCAGTTATACTCGAGTATAACTGGGTCAAATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024686.3-3340s1c1
Sequence:CCGGCCTCTGAAGTTGAACATGCAACTCGAGTTGCATGTTCAACTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024686
VALIDATED
TTLL7 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024686.4-760s21c1
Sequence:CCGGCCTCTGGATTATACCTTTGTTCTCGAGAACAAAGGTATAATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024686.4-2434s21c1
Sequence:CCGGCTAACAAGTCAGACCTTATTTCTCGAGAAATAAGGTCTGACTTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024686.4-3335s21c1
Sequence:CCGGTCTAGAATCTGCTAGGTTTATCTCGAGATAAACCTAGCAGATTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024686.4-1074s21c1
Sequence:CCGGGCGAATGGGTACAGAGAAGTACTCGAGTACTTCTCTGTACCCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024686.4-1750s21c1
Sequence:CCGGGGGAATTATAGACGAATTTATCTCGAGATAAATTCGTCTATAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024686.3-1196s1c1
Sequence:CCGGCCATCAAATGGTTTACAGAATCTCGAGATTCTGTAAACCATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024686.3-922s1c1
Sequence:CCGGCAGGATCATTTGATTGTTCAACTCGAGTTGAACAATCAAATGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-742s1c1
Sequence:CCGGCCTCTGGATTATACCTTTGTTCTCGAGAACAAAGGTATAATCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-1756s1c1
Sequence:CCGGCCTGAAGATAAAGCATTACTTCTCGAGAAGTAATGCTTTATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-1056s1c1
Sequence:CCGGGCGAATGGGTACAGAGAAGTACTCGAGTACTTCTCTGTACCCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-1092s1c1
Sequence:CCGGGTCCAATTTGACCCAGTTATACTCGAGTATAACTGGGTCAAATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024686.3-3340s1c1
Sequence:CCGGCCTCTGAAGTTGAACATGCAACTCGAGTTGCATGTTCAACTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024686
VALIDATED
TTLL7 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024686.4-760s21c1
Sequence:CCGGCCTCTGGATTATACCTTTGTTCTCGAGAACAAAGGTATAATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024686.4-2434s21c1
Sequence:CCGGCTAACAAGTCAGACCTTATTTCTCGAGAAATAAGGTCTGACTTGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024686.4-3335s21c1
Sequence:CCGGTCTAGAATCTGCTAGGTTTATCTCGAGATAAACCTAGCAGATTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024686.4-1074s21c1
Sequence:CCGGGCGAATGGGTACAGAGAAGTACTCGAGTACTTCTCTGTACCCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024686.4-1750s21c1
Sequence:CCGGGGGAATTATAGACGAATTTATCTCGAGATAAATTCGTCTATAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024686.3-1196s1c1
Sequence:CCGGCCATCAAATGGTTTACAGAATCTCGAGATTCTGTAAACCATTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024686.3-922s1c1
Sequence:CCGGCAGGATCATTTGATTGTTCAACTCGAGTTGAACAATCAAATGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-742s1c1
Sequence:CCGGCCTCTGGATTATACCTTTGTTCTCGAGAACAAAGGTATAATCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-1756s1c1
Sequence:CCGGCCTGAAGATAAAGCATTACTTCTCGAGAAGTAATGCTTTATCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-1056s1c1
Sequence:CCGGGCGAATGGGTACAGAGAAGTACTCGAGTACTTCTCTGTACCCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024686.3-1092s1c1
Sequence:CCGGGTCCAATTTGACCCAGTTATACTCGAGTATAACTGGGTCAAATTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024686.3-3340s1c1
Sequence:CCGGCCTCTGAAGTTGAACATGCAACTCGAGTTGCATGTTCAACTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027594
TTLL7 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-1263s21c1
Sequence:CCGGCTAAGTTCTGGAGTGATATTTCTCGAGAAATATCACTCCAGAACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027594.1-3085s21c1
Sequence:CCGGTTGCCATGGGCTCGCTTAATACTCGAGTATTAAGCGAGCCCATGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-2963s21c1
Sequence:CCGGCTACCAGGAAGTACCCAATTTCTCGAGAAATTGGGTACTTCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-2125s21c1
Sequence:CCGGACTAGACCAAGTCCCATATAGCTCGAGCTATATGGGACTTGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-753s21c1
Sequence:CCGGAGTCTCGGCCTATGGATTATACTCGAGTATAATCCATAGGCCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027594
TTLL7 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-1263s21c1
Sequence:CCGGCTAAGTTCTGGAGTGATATTTCTCGAGAAATATCACTCCAGAACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027594.1-3085s21c1
Sequence:CCGGTTGCCATGGGCTCGCTTAATACTCGAGTATTAAGCGAGCCCATGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-2963s21c1
Sequence:CCGGCTACCAGGAAGTACCCAATTTCTCGAGAAATTGGGTACTTCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-2125s21c1
Sequence:CCGGACTAGACCAAGTCCCATATAGCTCGAGCTATATGGGACTTGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-753s21c1
Sequence:CCGGAGTCTCGGCCTATGGATTATACTCGAGTATAATCCATAGGCCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027594
TTLL7 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-1263s21c1
Sequence:CCGGCTAAGTTCTGGAGTGATATTTCTCGAGAAATATCACTCCAGAACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027594.1-3085s21c1
Sequence:CCGGTTGCCATGGGCTCGCTTAATACTCGAGTATTAAGCGAGCCCATGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-2963s21c1
Sequence:CCGGCTACCAGGAAGTACCCAATTTCTCGAGAAATTGGGTACTTCCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-2125s21c1
Sequence:CCGGACTAGACCAAGTCCCATATAGCTCGAGCTATATGGGACTTGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027594.1-753s21c1
Sequence:CCGGAGTCTCGGCCTATGGATTATACTCGAGTATAATCCATAGGCCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks