EMAIL THIS PAGE TO A FRIEND

TTLL9

tubulin tyrosine ligase-like family, member 9

Synonyms: C20orf125 dJ310O13.1
Gene ID:
Mouse(74711) tubulin tyrosine ligase-like family, member 9
Rat(311548) tubulin tyrosine ligase-like family, member 9
cow(529246) tubulin tyrosine ligase-like family, member 9
sheep(101103255) tubulin tyrosine ligase-like family, member 9
domestic guinea pig(100734285) tubulin tyrosine ligase-like family, member 9
naked mole-rat(101711738) tubulin tyrosine ligase-like family, member 9
Zebrafish(556794) tubulin tyrosine ligase-like family, member 9
chicken(771843) tubulin tyrosine ligase-like family, member 9
Horse(100068497) tubulin tyrosine ligase-like family, member 9
domestic cat(101080271) tubulin tyrosine ligase-like family, member 9
dog(477188) tubulin tyrosine ligase-like family, member 9
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029064 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029064 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029064 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008409 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008409 Rosetta Predictions human pricing
NM_001014051 Rosetta Predictions rat pricing
NM_001083618 Rosetta Predictions mouse pricing
NM_029064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305451 predicted 1031
2 SASI_Hs02_00305452 predicted 1120
3 SASI_Hs02_00305453 predicted 1203
4 SASI_Hs01_00119139 predicted 1216
5 SASI_Hs02_00305454 predicted 339
6 SASI_Hs01_00119141 predicted 903
7 SASI_Hs02_00305455 predicted 368
8 SASI_Hs02_00305456 predicted 756
9 SASI_Hs01_00119143 predicted 669
10 SASI_Hs02_00305457 predicted 465
11 SASI_Hs01_00119136 predicted 927
12 SASI_Hs01_00119137 predicted 1605
13 SASI_Hs01_00119138 predicted 554
14 SASI_Hs01_00119140 predicted 1134
15 SASI_Hs01_00119142 predicted 860
16 SASI_Hs01_00119144 predicted 934
17 SASI_Hs01_00119145 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103780 predicted 665
2 SASI_Rn01_00103781 predicted 639
3 SASI_Rn01_00103782 predicted 280
4 SASI_Rn01_00103783 predicted 262
5 SASI_Rn01_00103785 predicted 1323
6 SASI_Rn01_00103786 predicted 713
7 SASI_Rn01_00103787 predicted 1032
8 SASI_Rn01_00103788 predicted 817
9 SASI_Rn01_00103789 predicted 1074
10 SASI_Rn02_00201446 predicted 395
11 SASI_Rn01_00103784 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299731 predicted 925
2 SASI_Mm02_00299732 predicted 796
3 SASI_Mm02_00299733 predicted 988
4 SASI_Mm02_00299734 predicted 804
5 SASI_Mm02_00299735 predicted 480
6 SASI_Mm02_00299736 predicted 743
7 SASI_Mm02_00299737 predicted 1083
8 SASI_Mm02_00299738 predicted 1125
9 SASI_Mm02_00299739 predicted 836
10 SASI_Mm02_00299740 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188678 predicted 929
2 SASI_Mm02_00334797 predicted 800
3 SASI_Mm02_00334798 predicted 991
4 SASI_Mm02_00334799 predicted 807
5 SASI_Mm02_00334800 predicted 474
6 SASI_Mm01_00188681 predicted 742
7 SASI_Mm01_00188682 predicted 1084
8 SASI_Mm02_00334801 predicted 1130
9 SASI_Mm01_00188685 predicted 839
10 SASI_Mm02_00334802 predicted 1047
11 SASI_Mm01_00188679 predicted 822
12 SASI_Mm01_00188680 predicted 340
13 SASI_Mm01_00188683 predicted 274
14 SASI_Mm01_00188684 predicted 991
15 SASI_Mm01_00188686 predicted 510
16 SASI_Mm01_00188687 predicted 1045
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029064
TTLL9 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-99s1c1
Sequence:CCGGGCAGAGAACCTTAATCCGCTTCTCGAGAAGCGGATTAAGGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-69s1c1
Sequence:CCGGCCATGGAGTGTCGAAAGGAAACTCGAGTTTCCTTTCGACACTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-102s1c1
Sequence:CCGGGAGAACCTTAATCCGCTTCAACTCGAGTTGAAGCGGATTAAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-846s1c1
Sequence:CCGGCCACTATGTTCACCTCACCAACTCGAGTTGGTGAGGTGAACATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-847s1c1
Sequence:CCGGCACTATGTTCACCTCACCAATCTCGAGATTGGTGAGGTGAACATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029064
TTLL9 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-99s1c1
Sequence:CCGGGCAGAGAACCTTAATCCGCTTCTCGAGAAGCGGATTAAGGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-69s1c1
Sequence:CCGGCCATGGAGTGTCGAAAGGAAACTCGAGTTTCCTTTCGACACTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-102s1c1
Sequence:CCGGGAGAACCTTAATCCGCTTCAACTCGAGTTGAAGCGGATTAAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-846s1c1
Sequence:CCGGCCACTATGTTCACCTCACCAACTCGAGTTGGTGAGGTGAACATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-847s1c1
Sequence:CCGGCACTATGTTCACCTCACCAATCTCGAGATTGGTGAGGTGAACATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029064
TTLL9 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-99s1c1
Sequence:CCGGGCAGAGAACCTTAATCCGCTTCTCGAGAAGCGGATTAAGGTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-69s1c1
Sequence:CCGGCCATGGAGTGTCGAAAGGAAACTCGAGTTTCCTTTCGACACTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-102s1c1
Sequence:CCGGGAGAACCTTAATCCGCTTCAACTCGAGTTGAAGCGGATTAAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-846s1c1
Sequence:CCGGCCACTATGTTCACCTCACCAACTCGAGTTGGTGAGGTGAACATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029064.1-847s1c1
Sequence:CCGGCACTATGTTCACCTCACCAATCTCGAGATTGGTGAGGTGAACATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008409
TTLL9 MISSION shRNA Bacterial Glycerol Stock
tubulin tyrosine ligase-like family, member 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008409.1-2204s1c1
Sequence:CCGGCCCTTGCTTTCCTCACTTGATCTCGAGATCAAGTGAGGAAAGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008409.1-1184s1c1
Sequence:CCGGGAAGGTGATCATCAGTGACAACTCGAGTTGTCACTGATGATCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008409.1-341s1c1
Sequence:CCGGCCATGGATTGTCAAAGGGAAACTCGAGTTTCCCTTTGACAATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008409.1-309s1c1
Sequence:CCGGCCCAAGAAATTACAGAACCAACTCGAGTTGGTTCTGTAATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008409.1-2413s1c1
Sequence:CCGGGCCTGTGTTTCTATGTAACTACTCGAGTAGTTACATAGAAACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008409
TTLL9 MISSION shRNA shRNA Plasmid DNA
tubulin tyrosine ligase-like family, member 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008409.1-2204s1c1
Sequence:CCGGCCCTTGCTTTCCTCACTTGATCTCGAGATCAAGTGAGGAAAGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008409.1-1184s1c1
Sequence:CCGGGAAGGTGATCATCAGTGACAACTCGAGTTGTCACTGATGATCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008409.1-341s1c1
Sequence:CCGGCCATGGATTGTCAAAGGGAAACTCGAGTTTCCCTTTGACAATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008409.1-309s1c1
Sequence:CCGGCCCAAGAAATTACAGAACCAACTCGAGTTGGTTCTGTAATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008409.1-2413s1c1
Sequence:CCGGGCCTGTGTTTCTATGTAACTACTCGAGTAGTTACATAGAAACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008409
TTLL9 MISSION shRNA Lentiviral Transduction Particles
tubulin tyrosine ligase-like family, member 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008409.1-2204s1c1
Sequence:CCGGCCCTTGCTTTCCTCACTTGATCTCGAGATCAAGTGAGGAAAGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008409.1-1184s1c1
Sequence:CCGGGAAGGTGATCATCAGTGACAACTCGAGTTGTCACTGATGATCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008409.1-341s1c1
Sequence:CCGGCCATGGATTGTCAAAGGGAAACTCGAGTTTCCCTTTGACAATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008409.1-309s1c1
Sequence:CCGGCCCAAGAAATTACAGAACCAACTCGAGTTGGTTCTGTAATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008409.1-2413s1c1
Sequence:CCGGGCCTGTGTTTCTATGTAACTACTCGAGTAGTTACATAGAAACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks