EMAIL THIS PAGE TO A FRIEND

TTN

titin

Synonyms: CMD1G CMH9 CMPD4 EOMFC HMERF LGMD2J MYLK5 TMD
Gene ID:
Human(7273) Summary: This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]
Mouse(22138) titin
Rat(84015) titin
dog(478820) titin
dog(478819) titin
cow(540561) titin
217 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003319 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_619763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_619763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_619763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_028004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003319 Rosetta Predictions human pricing
NM_133378 Rosetta Predictions human pricing
NM_133379 Rosetta Predictions human pricing
NM_133432 Rosetta Predictions human pricing
NM_133437 Rosetta Predictions human pricing
XM_001065955 Rosetta Predictions rat pricing
XM_342452 Rosetta Predictions rat pricing
XM_575155 Rosetta Predictions rat pricing
NM_011652 Rosetta Predictions mouse pricing
NM_028004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335449 predicted 2364
2 SASI_Hs01_00106836 predicted 235
3 SASI_Hs01_00106837 predicted 7620
4 SASI_Hs01_00106838 predicted 9663
5 SASI_Hs02_00335450 predicted 7959
6 SASI_Hs01_00106840 predicted 9513
7 SASI_Hs01_00106841 predicted 4125
8 SASI_Hs02_00335451 predicted 2951
9 SASI_Hs01_00106842 predicted 3543
10 SASI_Hs02_00335452 predicted 1540
11 SASI_Hs01_00106839 predicted 4999
12 SASI_Hs01_00106843 predicted 9275
13 SASI_Hs01_00106844 predicted 5559
14 SASI_Hs01_00106845 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363091 predicted 2508
2 SASI_Hs01_00167313 predicted 236
3 SASI_Hs01_00167314 predicted 7760
4 SASI_Hs01_00167315 predicted 9792
5 SASI_Hs02_00363092 predicted 8100
6 SASI_Hs01_00167316 predicted 9653
7 SASI_Hs02_00363093 predicted 3087
8 SASI_Hs01_00167318 predicted 3684
9 SASI_Hs02_00363094 predicted 5679
10 SASI_Hs01_00167320 predicted 1539
11 SASI_Hs01_00167317 predicted 4267
12 SASI_Hs01_00167319 predicted 9411
13 SASI_Hs01_00167321 predicted 5703
14 SASI_Hs01_00167322 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363095 predicted 2511
2 SASI_Hs01_00192845 predicted 240
3 SASI_Hs01_00192846 predicted 7754
4 SASI_Hs01_00192847 predicted 9798
5 SASI_Hs02_00363096 predicted 8096
6 SASI_Hs01_00192849 predicted 9651
7 SASI_Hs02_00363097 predicted 3084
8 SASI_Hs01_00192851 predicted 3679
9 SASI_Hs02_00363098 predicted 5677
10 SASI_Hs02_00363099 predicted 1539
11 SASI_Hs01_00192848 predicted 5143
12 SASI_Hs01_00192850 predicted 4267
13 SASI_Hs01_00192852 predicted 9416
14 SASI_Hs01_00192853 predicted 5701
15 SASI_Hs01_00192854 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363101 predicted 2373
2 SASI_Hs01_00109355 predicted 241
3 SASI_Hs01_00109356 predicted 7616
4 SASI_Hs01_00109357 predicted 9658
5 SASI_Hs02_00363102 predicted 7965
6 SASI_Hs01_00109359 predicted 9515
7 SASI_Hs02_00363103 predicted 2951
8 SASI_Hs01_00109361 predicted 3546
9 SASI_Hs02_00363104 predicted 5541
10 SASI_Hs02_00363105 predicted 1543
11 SASI_Hs01_00109358 predicted 4997
12 SASI_Hs01_00109360 predicted 4128
13 SASI_Hs01_00109362 predicted 9278
14 SASI_Hs01_00109363 predicted 5567
15 SASI_Hs01_00109364 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363110 predicted 2364
2 SASI_Hs01_00167293 predicted 237
3 SASI_Hs01_00167294 predicted 7618
4 SASI_Hs01_00167295 predicted 9654
5 SASI_Hs02_00363111 predicted 7960
6 SASI_Hs01_00167296 predicted 9520
7 SASI_Hs02_00363112 predicted 2950
8 SASI_Hs01_00167298 predicted 3545
9 SASI_Hs02_00363113 predicted 5536
10 SASI_Hs01_00167300 predicted 1542
11 SASI_Hs01_00167297 predicted 4136
12 SASI_Hs01_00167299 predicted 9271
13 SASI_Hs01_00167301 predicted 5560
14 SASI_Hs01_00167302 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315889 predicted 13844
2 SASI_Rn02_00315890 predicted 91827
3 SASI_Rn02_00315891 predicted 25971
4 SASI_Rn02_00315892 predicted 21169
5 SASI_Rn02_00315893 predicted 51331
6 SASI_Rn02_00315894 predicted 82917
7 SASI_Rn02_00315895 predicted 4078
8 SASI_Rn02_00315896 predicted 25436
9 SASI_Rn02_00315897 predicted 24057
10 SASI_Rn02_00315898 predicted 87933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342452 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146304 predicted 19931
2 SASI_Rn01_00146305 predicted 23399
3 SASI_Rn01_00146306 predicted 31472
4 SASI_Rn01_00146307 predicted 35281
5 SASI_Rn01_00146308 predicted 30481
6 SASI_Rn01_00146309 predicted 32067
7 SASI_Rn01_00146310 predicted 31354
8 SASI_Rn01_00146311 predicted 12826
9 SASI_Rn01_00146312 predicted 4733
10 SASI_Rn01_00146313 predicted 34748
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403181 predicted 14567
2 SASI_Rn02_00403182 predicted 13940
3 SASI_Rn02_00403183 predicted 18950
4 SASI_Rn02_00403184 predicted 9796
5 SASI_Rn02_00403185 predicted 5034
6 SASI_Rn02_00403186 predicted 20005
7 SASI_Rn02_00403187 predicted 10047
8 SASI_Rn02_00403188 predicted 10298
9 SASI_Rn02_00403189 predicted 14158
10 SASI_Rn02_00403190 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061935 predicted 91494
2 SASI_Mm01_00061937 predicted 49510
3 SASI_Mm01_00061938 predicted 74244
4 SASI_Mm02_00321141 predicted 91543
5 SASI_Mm02_00321142 predicted 99929
6 SASI_Mm01_00061939 predicted 77307
7 SASI_Mm01_00061941 predicted 56214
8 SASI_Mm01_00061942 predicted 97930
9 SASI_Mm01_00061943 predicted 52772
10 SASI_Mm01_00061944 predicted 87399
11 SASI_Mm01_00061936 predicted 13850
12 SASI_Mm01_00061940 predicted 64626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074229 predicted 71755
2 SASI_Mm01_00074230 predicted 29767
3 SASI_Mm01_00074231 predicted 54505
4 SASI_Mm02_00333100 predicted 71797
5 SASI_Mm02_00333101 predicted 80188
6 SASI_Mm01_00074232 predicted 57566
7 SASI_Mm01_00074233 predicted 10515
8 SASI_Mm01_00074235 predicted 36468
9 SASI_Mm01_00074236 predicted 78192
10 SASI_Mm01_00074237 predicted 33031
11 SASI_Mm01_00074234 predicted 44890
12 SASI_Mm01_00074238 predicted 67668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003319
TTN MISSION shRNA Bacterial Glycerol Stock
titin
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-29609s1c1
Sequence:CCGGGCCCAGAATAAATATGGCATTCTCGAGAATGCCATATTTATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-23741s1c1
Sequence:CCGGCGCCCAATAAAGGACTTGAAACTCGAGTTTCAAGTCCTTTATTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-3325s1c1
Sequence:CCGGCGCGCCTTACTTTATTACAAACTCGAGTTTGTAATAAAGTAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-8123s1c1
Sequence:CCGGGCCACCAAATTAGATGACATTCTCGAGAATGTCATCTAATTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-45830s1c1
Sequence:CCGGCGCTGGATTAAATGCAACAAACTCGAGTTTGTTGCATTTAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003319.2-81443s1c1
Sequence:CCGGGCTGTGCATATCACTTGATATCTCGAGATATCAAGTGATATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003319.2-39718s1c1
Sequence:CCGGCCGTGTGTATGCCGTTAATAACTCGAGTTATTAACGGCATACACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003319.2-81017s1c1
Sequence:CCGGCCTTATACTCTACACTCATTCCTCGAGGAATGAGTGTAGAGTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003319.2-81614s1c1
Sequence:CCGGCAACACTTTGTTCGCTCATTTCTCGAGAAATGAGCGAACAAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-49509s21c2
Sequence:CCGGGACGTCCCTGGACCTATTATACTCGAGTATAATAGGTCCAGGGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003319.3-81220s21c2
Sequence:GTACCGGAGCCGGATTAACGGTTATAAACTCGAGTTTATAACCGTTAATCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-39410s21c2
Sequence:CCGGGTTCCGTGTTACAGCTATAAACTCGAGTTTATAGCTGTAACACGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-39718s21c2
Sequence:CCGGTCCGTGTGTATGCCGTTAATACTCGAGTATTAACGGCATACACACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-56657s21c2
Sequence:CCGGCCGTAATACAGCTACAATTAACTCGAGTTAATTGTAGCTGTATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003319
TTN MISSION shRNA shRNA Plasmid DNA
titin
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-29609s1c1
Sequence:CCGGGCCCAGAATAAATATGGCATTCTCGAGAATGCCATATTTATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-23741s1c1
Sequence:CCGGCGCCCAATAAAGGACTTGAAACTCGAGTTTCAAGTCCTTTATTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-3325s1c1
Sequence:CCGGCGCGCCTTACTTTATTACAAACTCGAGTTTGTAATAAAGTAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-8123s1c1
Sequence:CCGGGCCACCAAATTAGATGACATTCTCGAGAATGTCATCTAATTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-45830s1c1
Sequence:CCGGCGCTGGATTAAATGCAACAAACTCGAGTTTGTTGCATTTAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003319.2-81443s1c1
Sequence:CCGGGCTGTGCATATCACTTGATATCTCGAGATATCAAGTGATATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003319.2-39718s1c1
Sequence:CCGGCCGTGTGTATGCCGTTAATAACTCGAGTTATTAACGGCATACACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003319.2-81017s1c1
Sequence:CCGGCCTTATACTCTACACTCATTCCTCGAGGAATGAGTGTAGAGTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003319.2-81614s1c1
Sequence:CCGGCAACACTTTGTTCGCTCATTTCTCGAGAAATGAGCGAACAAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-49509s21c2
Sequence:CCGGGACGTCCCTGGACCTATTATACTCGAGTATAATAGGTCCAGGGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003319.3-81220s21c2
Sequence:GTACCGGAGCCGGATTAACGGTTATAAACTCGAGTTTATAACCGTTAATCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-39410s21c2
Sequence:CCGGGTTCCGTGTTACAGCTATAAACTCGAGTTTATAGCTGTAACACGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-39718s21c2
Sequence:CCGGTCCGTGTGTATGCCGTTAATACTCGAGTATTAACGGCATACACACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-56657s21c2
Sequence:CCGGCCGTAATACAGCTACAATTAACTCGAGTTAATTGTAGCTGTATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003319
TTN MISSION shRNA Lentiviral Transduction Particles
titin
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-29609s1c1
Sequence:CCGGGCCCAGAATAAATATGGCATTCTCGAGAATGCCATATTTATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-23741s1c1
Sequence:CCGGCGCCCAATAAAGGACTTGAAACTCGAGTTTCAAGTCCTTTATTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-3325s1c1
Sequence:CCGGCGCGCCTTACTTTATTACAAACTCGAGTTTGTAATAAAGTAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-8123s1c1
Sequence:CCGGGCCACCAAATTAGATGACATTCTCGAGAATGTCATCTAATTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003319.2-45830s1c1
Sequence:CCGGCGCTGGATTAAATGCAACAAACTCGAGTTTGTTGCATTTAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196828    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003319.2-81443s1c1
Sequence:CCGGGCTGTGCATATCACTTGATATCTCGAGATATCAAGTGATATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003319.2-39718s1c1
Sequence:CCGGCCGTGTGTATGCCGTTAATAACTCGAGTTATTAACGGCATACACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003319.2-81017s1c1
Sequence:CCGGCCTTATACTCTACACTCATTCCTCGAGGAATGAGTGTAGAGTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003319.2-81614s1c1
Sequence:CCGGCAACACTTTGTTCGCTCATTTCTCGAGAAATGAGCGAACAAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-49509s21c2
Sequence:CCGGGACGTCCCTGGACCTATTATACTCGAGTATAATAGGTCCAGGGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003319.3-81220s21c2
Sequence:GTACCGGAGCCGGATTAACGGTTATAAACTCGAGTTTATAACCGTTAATCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-39410s21c2
Sequence:CCGGGTTCCGTGTTACAGCTATAAACTCGAGTTTATAGCTGTAACACGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-39718s21c2
Sequence:CCGGTCCGTGTGTATGCCGTTAATACTCGAGTATTAACGGCATACACACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003319.3-56657s21c2
Sequence:CCGGCCGTAATACAGCTACAATTAACTCGAGTTAATTGTAGCTGTATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_619763
TTN MISSION shRNA Bacterial Glycerol Stock
titin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-12635s1c1
Sequence:CCGGCGGCCAAAGTTCCTGAAATTACTCGAGTAATTTCAGGAACTTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-4927s1c1
Sequence:CCGGCCGTTGAAAGACAGCCCAAATCTCGAGATTTGGGCTGTCTTTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-6735s1c1
Sequence:CCGGGCCCAGTAACAAATATGAAATCTCGAGATTTCATATTTGTTACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-18161s1c1
Sequence:CCGGCCAGAGAGAAAGCGAATGTAACTCGAGTTACATTCGCTTTCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-745s1c1
Sequence:CCGGCCCTTCACATTGGAGTGTGTACTCGAGTACACACTCCAATGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_619763
TTN MISSION shRNA shRNA Plasmid DNA
titin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-12635s1c1
Sequence:CCGGCGGCCAAAGTTCCTGAAATTACTCGAGTAATTTCAGGAACTTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-4927s1c1
Sequence:CCGGCCGTTGAAAGACAGCCCAAATCTCGAGATTTGGGCTGTCTTTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-6735s1c1
Sequence:CCGGGCCCAGTAACAAATATGAAATCTCGAGATTTCATATTTGTTACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-18161s1c1
Sequence:CCGGCCAGAGAGAAAGCGAATGTAACTCGAGTTACATTCGCTTTCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-745s1c1
Sequence:CCGGCCCTTCACATTGGAGTGTGTACTCGAGTACACACTCCAATGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_619763
TTN MISSION shRNA Lentiviral Transduction Particles
titin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-12635s1c1
Sequence:CCGGCGGCCAAAGTTCCTGAAATTACTCGAGTAATTTCAGGAACTTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-4927s1c1
Sequence:CCGGCCGTTGAAAGACAGCCCAAATCTCGAGATTTGGGCTGTCTTTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-6735s1c1
Sequence:CCGGGCCCAGTAACAAATATGAAATCTCGAGATTTCATATTTGTTACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-18161s1c1
Sequence:CCGGCCAGAGAGAAAGCGAATGTAACTCGAGTTACATTCGCTTTCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_619763.1-745s1c1
Sequence:CCGGCCCTTCACATTGGAGTGTGTACTCGAGTACACACTCCAATGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028004
TTN MISSION shRNA Bacterial Glycerol Stock
titin
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000363030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028004.2-5069s21c1
Sequence:CCGGCCGGAAAGAAAGCTGATTATTCTCGAGAATAATCAGCTTTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028004.2-34151s21c1
Sequence:CCGGGCGCAGTGGGATAGGATTAATCTCGAGATTAATCCTATCCCACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028004.2-32449s21c1
Sequence:CCGGCCACGAAGATGGTGGTATTTACTCGAGTAAATACCACCATCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028004
TTN MISSION shRNA shRNA Plasmid DNA
titin
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000363030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028004.2-5069s21c1
Sequence:CCGGCCGGAAAGAAAGCTGATTATTCTCGAGAATAATCAGCTTTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028004.2-34151s21c1
Sequence:CCGGGCGCAGTGGGATAGGATTAATCTCGAGATTAATCCTATCCCACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028004.2-32449s21c1
Sequence:CCGGCCACGAAGATGGTGGTATTTACTCGAGTAAATACCACCATCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028004
TTN MISSION shRNA Lentiviral Transduction Particles
titin
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000363030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028004.2-5069s21c1
Sequence:CCGGCCGGAAAGAAAGCTGATTATTCTCGAGAATAATCAGCTTTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028004.2-34151s21c1
Sequence:CCGGGCGCAGTGGGATAGGATTAATCTCGAGATTAATCCTATCCCACTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028004.2-32449s21c1
Sequence:CCGGCCACGAAGATGGTGGTATTTACTCGAGTAAATACCACCATCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks