EMAIL THIS PAGE TO A FRIEND

TTPA

tocopherol (alpha) transfer protein

Synonyms: ATTP AVED TTP1 alphaTTP
UniProtKB ID: P49638, Q71V64
Gene ID:
Human(7274) Summary: This gene encodes a soluble protein that binds alpha-trocopherol, a form of vitamin E, with high selectivity and affinity. This protein plays an important role in regulating vitamin E levels in the body by transporting vitamin E between membrane vesicles and facilitating the secretion of vitamin E from hepatocytes to circulating lipoproteins. Mutations in this gene cause hereditary vitamin E deficiency (ataxia with vitamin E deficiency, AVED) and retinitis pigmentosa. [provided by RefSeq, Nov 2009]
Mouse(50500) tocopherol (alpha) transfer protein
Rat(25571) tocopherol (alpha) transfer protein
Zebrafish(325906) tocopherol (alpha) transfer protein
dog(403627) tocopherol (alpha) transfer protein
domestic cat(101085268) tocopherol (alpha) transfer protein
chicken(771074) tocopherol (alpha) transfer protein
cow(286813) tocopherol (alpha) transfer protein
sheep(100526668) tocopherol (alpha) transfer protein
domestic guinea pig(100721304) tocopherol (alpha) transfer protein
naked mole-rat(101723314) tocopherol (alpha) transfer protein
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000370 Rosetta Predictions human pricing
NM_013048 Rosetta Predictions rat pricing
NM_015767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129216 predicted 579
2 SASI_Hs01_00129217 predicted 551
3 SASI_Hs01_00129218 predicted 449
4 SASI_Hs01_00129219 predicted 713
5 SASI_Hs01_00129220 predicted 488
6 SASI_Hs01_00129221 predicted 778
7 SASI_Hs01_00129222 predicted 415
8 SASI_Hs01_00129223 predicted 569
9 SASI_Hs01_00129224 predicted 598
10 SASI_Hs01_00129225 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049746 predicted 924
2 SASI_Rn01_00049747 predicted 381
3 SASI_Rn01_00049748 predicted 259
4 SASI_Rn01_00049749 predicted 554
5 SASI_Rn01_00049750 predicted 528
6 SASI_Rn01_00049751 predicted 797
7 SASI_Rn01_00049752 predicted 273
8 SASI_Rn01_00049753 predicted 877
9 SASI_Rn02_00260774 predicted 261
10 SASI_Rn01_00049755 predicted 910
11 SASI_Rn01_00049754 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158930 predicted 420
2 SASI_Mm01_00158931 predicted 718
3 SASI_Mm01_00158932 predicted 259
4 SASI_Mm01_00158933 predicted 913
5 SASI_Mm02_00323100 predicted 618
6 SASI_Mm01_00158935 predicted 810
7 SASI_Mm01_00158936 predicted 731
8 SASI_Mm01_00158937 predicted 930
9 SASI_Mm01_00158938 predicted 560
10 SASI_Mm01_00158939 predicted 274
11 SASI_Mm01_00158934 predicted 827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000370
TTPA MISSION shRNA Bacterial Glycerol Stock
tocopherol (alpha) transfer protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000370.3-914s21c1
Sequence:CCGGTGATATCCAACCTGGTTAAATCTCGAGATTTAACCAGGTTGGATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000370.3-583s21c1
Sequence:CCGGCGGATTCATTTCCATTGAAAGCTCGAGCTTTCAATGGAAATGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000370.3-883s21c1
Sequence:CCGGGTGAATGGCTTCCTAACTAAACTCGAGTTTAGTTAGGAAGCCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000370.3-857s21c1
Sequence:CCGGGAGCATTCAATGAGAAGTTATCTCGAGATAACTTCTCATTGAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-544s1c1
Sequence:CCGGGCCAAGAAGATTGCTGCTGTACTCGAGTACAGCAGCAATCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-403s1c1
Sequence:CCGGGCTTATGACGTATTTCGAGTACTCGAGTACTCGAAATACGTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-282s1c1
Sequence:CCGGCCCTAGAAGTATTATTGGCCTCTCGAGAGGCCAATAATACTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-592s1c1
Sequence:CCGGCGTGGCATCCATTTGATAAATCTCGAGATTTATCAAATGGATGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000370
TTPA MISSION shRNA shRNA Plasmid DNA
tocopherol (alpha) transfer protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000370.3-914s21c1
Sequence:CCGGTGATATCCAACCTGGTTAAATCTCGAGATTTAACCAGGTTGGATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000370.3-583s21c1
Sequence:CCGGCGGATTCATTTCCATTGAAAGCTCGAGCTTTCAATGGAAATGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000370.3-883s21c1
Sequence:CCGGGTGAATGGCTTCCTAACTAAACTCGAGTTTAGTTAGGAAGCCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000370.3-857s21c1
Sequence:CCGGGAGCATTCAATGAGAAGTTATCTCGAGATAACTTCTCATTGAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-544s1c1
Sequence:CCGGGCCAAGAAGATTGCTGCTGTACTCGAGTACAGCAGCAATCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-403s1c1
Sequence:CCGGGCTTATGACGTATTTCGAGTACTCGAGTACTCGAAATACGTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-282s1c1
Sequence:CCGGCCCTAGAAGTATTATTGGCCTCTCGAGAGGCCAATAATACTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-592s1c1
Sequence:CCGGCGTGGCATCCATTTGATAAATCTCGAGATTTATCAAATGGATGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000370
TTPA MISSION shRNA Lentiviral Transduction Particles
tocopherol (alpha) transfer protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000370.3-914s21c1
Sequence:CCGGTGATATCCAACCTGGTTAAATCTCGAGATTTAACCAGGTTGGATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000370.3-583s21c1
Sequence:CCGGCGGATTCATTTCCATTGAAAGCTCGAGCTTTCAATGGAAATGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000370.3-883s21c1
Sequence:CCGGGTGAATGGCTTCCTAACTAAACTCGAGTTTAGTTAGGAAGCCATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000370.3-857s21c1
Sequence:CCGGGAGCATTCAATGAGAAGTTATCTCGAGATAACTTCTCATTGAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-544s1c1
Sequence:CCGGGCCAAGAAGATTGCTGCTGTACTCGAGTACAGCAGCAATCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-403s1c1
Sequence:CCGGGCTTATGACGTATTTCGAGTACTCGAGTACTCGAAATACGTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-282s1c1
Sequence:CCGGCCCTAGAAGTATTATTGGCCTCTCGAGAGGCCAATAATACTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000370.1-592s1c1
Sequence:CCGGCGTGGCATCCATTTGATAAATCTCGAGATTTATCAAATGGATGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015767
TTPA MISSION shRNA Bacterial Glycerol Stock
tocopherol (alpha) transfer protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015767.3-579s21c1
Sequence:CCGGGAAAGTTCGTGGGATCCATTTCTCGAGAAATGGATCCCACGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015767.3-465s21c1
Sequence:CCGGCAATGGAGTTAAAGCTATATTCTCGAGAATATAGCTTTAACTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015767.3-1306s21c1
Sequence:CCGGGTAAATCCTACTCTAGCAAATCTCGAGATTTGCTAGAGTAGGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015767.1-1867s1c1
Sequence:CCGGGCCTTCAACTTCTGGCATAATCTCGAGATTATGCCAGAAGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-728s1c1
Sequence:CCGGGACATTCTTCCTCGGGAATATCTCGAGATATTCCCGAGGAAGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-278s1c1
Sequence:CCGGCCTAGAAGTATCCTTGGACTTCTCGAGAAGTCCAAGGATACTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-554s1c1
Sequence:CCGGGCTGTACTTACAGATTCCTTTCTCGAGAAAGGAATCTGTAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-812s1c1
Sequence:CCGGGAAGATTATCTCAGCAGCATTCTCGAGAATGCTGCTGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015767
TTPA MISSION shRNA shRNA Plasmid DNA
tocopherol (alpha) transfer protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015767.3-579s21c1
Sequence:CCGGGAAAGTTCGTGGGATCCATTTCTCGAGAAATGGATCCCACGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015767.3-465s21c1
Sequence:CCGGCAATGGAGTTAAAGCTATATTCTCGAGAATATAGCTTTAACTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015767.3-1306s21c1
Sequence:CCGGGTAAATCCTACTCTAGCAAATCTCGAGATTTGCTAGAGTAGGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015767.1-1867s1c1
Sequence:CCGGGCCTTCAACTTCTGGCATAATCTCGAGATTATGCCAGAAGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-728s1c1
Sequence:CCGGGACATTCTTCCTCGGGAATATCTCGAGATATTCCCGAGGAAGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-278s1c1
Sequence:CCGGCCTAGAAGTATCCTTGGACTTCTCGAGAAGTCCAAGGATACTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-554s1c1
Sequence:CCGGGCTGTACTTACAGATTCCTTTCTCGAGAAAGGAATCTGTAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-812s1c1
Sequence:CCGGGAAGATTATCTCAGCAGCATTCTCGAGAATGCTGCTGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015767
TTPA MISSION shRNA Lentiviral Transduction Particles
tocopherol (alpha) transfer protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015767.3-579s21c1
Sequence:CCGGGAAAGTTCGTGGGATCCATTTCTCGAGAAATGGATCCCACGAACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015767.3-465s21c1
Sequence:CCGGCAATGGAGTTAAAGCTATATTCTCGAGAATATAGCTTTAACTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015767.3-1306s21c1
Sequence:CCGGGTAAATCCTACTCTAGCAAATCTCGAGATTTGCTAGAGTAGGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015767.1-1867s1c1
Sequence:CCGGGCCTTCAACTTCTGGCATAATCTCGAGATTATGCCAGAAGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-728s1c1
Sequence:CCGGGACATTCTTCCTCGGGAATATCTCGAGATATTCCCGAGGAAGAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-278s1c1
Sequence:CCGGCCTAGAAGTATCCTTGGACTTCTCGAGAAGTCCAAGGATACTTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-554s1c1
Sequence:CCGGGCTGTACTTACAGATTCCTTTCTCGAGAAAGGAATCTGTAAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015767.1-812s1c1
Sequence:CCGGGAAGATTATCTCAGCAGCATTCTCGAGAATGCTGCTGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks