EMAIL THIS PAGE TO A FRIEND

TTPAL

tocopherol (alpha) transfer protein-like

Synonyms: C20orf121
UniProtKB ID: Q9BTX7, E1P5X3, Q5QPC1, Q9H1G2, Q9NQG8
Gene ID:
Mouse(76080) tocopherol (alpha) transfer protein-like
Rat(296349) tocopherol (alpha) transfer protein-like
naked mole-rat(101709427) tocopherol (alpha) transfer protein-like
Domestic Rabbit(100348692) tocopherol (alpha) transfer protein-like
domestic guinea pig(100713738) tocopherol (alpha) transfer protein-like
cow(526582) tocopherol (alpha) transfer protein-like
sheep(101109033) tocopherol (alpha) transfer protein-like
Zebrafish(321577) tocopherol (alpha) transfer protein-like
dog(477234) tocopherol (alpha) transfer protein-like
Horse(100056046) tocopherol (alpha) transfer protein-like
domestic cat(101092427) tocopherol (alpha) transfer protein-like
chicken(419197) tocopherol (alpha) transfer protein-like
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024331 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039199 Rosetta Predictions human pricing
NM_024331 Rosetta Predictions human pricing
NM_001106537 Rosetta Predictions rat pricing
NM_029512 Rosetta Predictions mouse pricing
NM_181734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043540 predicted 588
2 SASI_Hs01_00043541 predicted 560
3 SASI_Hs01_00043542 predicted 784
4 SASI_Hs01_00043543 predicted 1209
5 SASI_Hs01_00043544 predicted 644
6 SASI_Hs01_00043545 predicted 684
7 SASI_Hs01_00043546 predicted 1363
8 SASI_Hs01_00043547 predicted 653
9 SASI_Hs01_00043548 predicted 630
10 SASI_Hs01_00043549 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136466 predicted 613
2 SASI_Hs01_00136467 predicted 585
3 SASI_Hs01_00136468 predicted 801
4 SASI_Hs01_00136469 predicted 1234
5 SASI_Hs01_00136470 predicted 671
6 SASI_Hs01_00136471 predicted 704
7 SASI_Hs01_00136472 predicted 1386
8 SASI_Hs01_00136473 predicted 679
9 SASI_Hs01_00136474 predicted 654
10 SASI_Hs01_00136475 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219928 predicted 1126
2 SASI_Rn02_00219929 predicted 542
3 SASI_Rn02_00219930 predicted 1319
4 SASI_Rn02_00219931 predicted 574
5 SASI_Rn02_00219932 predicted 634
6 SASI_Rn02_00219933 predicted 1413
7 SASI_Rn02_00219934 predicted 745
8 SASI_Rn02_00219935 predicted 1303
9 SASI_Rn02_00219936 predicted 656
10 SASI_Rn02_00219937 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335455 predicted 488
2 SASI_Mm02_00335456 predicted 663
3 SASI_Mm02_00335457 predicted 599
4 SASI_Mm02_00335458 predicted 1293
5 SASI_Mm02_00335459 predicted 607
6 SASI_Mm02_00335460 predicted 1349
7 SASI_Mm02_00335461 predicted 577
8 SASI_Mm02_00335462 predicted 683
9 SASI_Mm02_00335463 predicted 804
10 SASI_Mm02_00335464 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162095 predicted 487
2 SASI_Mm01_00162096 predicted 659
3 SASI_Mm01_00162098 predicted 593
4 SASI_Mm01_00162100 predicted 1294
5 SASI_Mm01_00162101 predicted 607
6 SASI_Mm01_00162102 predicted 1345
7 SASI_Mm01_00162104 predicted 571
8 SASI_Mm02_00349902 predicted 673
9 SASI_Mm02_00349903 predicted 800
10 SASI_Mm02_00349904 predicted 1431
11 SASI_Mm01_00162097 predicted 1370
12 SASI_Mm01_00162099 predicted 1146
13 SASI_Mm01_00162103 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024331
VALIDATED
TTPAL MISSION shRNA Bacterial Glycerol Stock
tocopherol (alpha) transfer protein-like
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000149418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024331.2-611s1c1
Sequence:CCGGCGAGCCATATACTTGACCTTACTCGAGTAAGGTCAAGTATATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024331.2-1539s1c1
Sequence:CCGGGCCAGTGAGAACTACTTGTATCTCGAGATACAAGTAGTTCTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024331.2-684s1c1
Sequence:CCGGCAGACTACAAAGGAGTGAGTTCTCGAGAACTCACTCCTTTGTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024331
VALIDATED
TTPAL MISSION shRNA shRNA Plasmid DNA
tocopherol (alpha) transfer protein-like
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000149418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024331.2-611s1c1
Sequence:CCGGCGAGCCATATACTTGACCTTACTCGAGTAAGGTCAAGTATATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024331.2-1539s1c1
Sequence:CCGGGCCAGTGAGAACTACTTGTATCTCGAGATACAAGTAGTTCTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024331.2-684s1c1
Sequence:CCGGCAGACTACAAAGGAGTGAGTTCTCGAGAACTCACTCCTTTGTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024331
VALIDATED
TTPAL MISSION shRNA Lentiviral Transduction Particles
tocopherol (alpha) transfer protein-like
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000149418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024331.2-611s1c1
Sequence:CCGGCGAGCCATATACTTGACCTTACTCGAGTAAGGTCAAGTATATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024331.2-1539s1c1
Sequence:CCGGGCCAGTGAGAACTACTTGTATCTCGAGATACAAGTAGTTCTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024331.2-684s1c1
Sequence:CCGGCAGACTACAAAGGAGTGAGTTCTCGAGAACTCACTCCTTTGTAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029512
VALIDATED
TTPAL MISSION shRNA Bacterial Glycerol Stock
tocopherol (alpha) transfer protein-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-441s1c1
Sequence:CCGGCCCTGAAAGACGTTCTCAACTCTCGAGAGTTGAGAACGTCTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029512.1-187s1c1
Sequence:CCGGGACAGAAGACTTGGTCACCAACTCGAGTTGGTGACCAAGTCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-565s1c1
Sequence:CCGGTGAACGAACCTCGGATATTTACTCGAGTAAATATCCGAGGTTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-552s1c1
Sequence:CCGGGCAGTTCACATAGTGAACGAACTCGAGTTCGTTCACTATGTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-895s1c1
Sequence:CCGGCCAGCTCTACTCCTGCTATTACTCGAGTAATAGCAGGAGTAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029512
VALIDATED
TTPAL MISSION shRNA shRNA Plasmid DNA
tocopherol (alpha) transfer protein-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-441s1c1
Sequence:CCGGCCCTGAAAGACGTTCTCAACTCTCGAGAGTTGAGAACGTCTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029512.1-187s1c1
Sequence:CCGGGACAGAAGACTTGGTCACCAACTCGAGTTGGTGACCAAGTCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-565s1c1
Sequence:CCGGTGAACGAACCTCGGATATTTACTCGAGTAAATATCCGAGGTTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-552s1c1
Sequence:CCGGGCAGTTCACATAGTGAACGAACTCGAGTTCGTTCACTATGTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-895s1c1
Sequence:CCGGCCAGCTCTACTCCTGCTATTACTCGAGTAATAGCAGGAGTAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029512
VALIDATED
TTPAL MISSION shRNA Lentiviral Transduction Particles
tocopherol (alpha) transfer protein-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-441s1c1
Sequence:CCGGCCCTGAAAGACGTTCTCAACTCTCGAGAGTTGAGAACGTCTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029512.1-187s1c1
Sequence:CCGGGACAGAAGACTTGGTCACCAACTCGAGTTGGTGACCAAGTCTTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-565s1c1
Sequence:CCGGTGAACGAACCTCGGATATTTACTCGAGTAAATATCCGAGGTTCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-552s1c1
Sequence:CCGGGCAGTTCACATAGTGAACGAACTCGAGTTCGTTCACTATGTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029512.1-895s1c1
Sequence:CCGGCCAGCTCTACTCCTGCTATTACTCGAGTAATAGCAGGAGTAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks