EMAIL THIS PAGE TO A FRIEND

TTR

transthyretin

Synonyms: CTS CTS1 HsT2651 PALB TBPA
UniProtKB ID: P02766, Q549C7, Q6IB96, Q9UBZ6, Q9UCM9
Gene ID:
Human(7276) Summary: This gene encodes transthyretin, one of the three prealbumins including alpha-1-antitrypsin, transthyretin and orosomucoid. Transthyretin is a carrier protein; it transports thyroid hormones in the plasma and cerebrospinal fluid, and also transports retinol (vitamin A) in the plasma. The protein consists of a tetramer of identical subunits. More than 80 different mutations in this gene have been reported; most mutations are related to amyloid deposition, affecting predominantly peripheral nerve and/or the heart, and a small portion of the gene mutations is non-amyloidogenic. The diseases caused by mutations include amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis, carpal tunnel syndrome, etc. [provided by RefSeq, Jan 2009]
Mouse(22139) transthyretin
Rat(24856) transthyretin
fruit fly(246932) tetrapter
domestic cat(101085927) transthyretin
dog(480167) transthyretin
chicken(396277) transthyretin
Zebrafish(449556) transthyretin (prealbumin, amyloidosis type I)
cow(280948) transthyretin
sheep(443389) transthyretin
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
T2376 L-Thyroxine ≥98% (HPLC) human, mouse, rat pricing
T1775 L-Thyroxine powder, BioReagent, suitable for cell culture human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0553 AQUA Peptide GSPAINVAVHVF[R] human pricing
AQ0555 AQUA Peptide STTAVVTNP[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000371 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000371 Rosetta Predictions human pricing
NM_012681 Rosetta Predictions rat pricing
NM_013697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023573 predicted 205
2 SASI_Hs01_00023576 predicted 245
3 SASI_Hs01_00023578 predicted 229
4 SASI_Hs01_00023579 predicted 301
5 SASI_Hs01_00023581 predicted 298
6 SASI_Hs02_00302422 predicted 303
7 SASI_Hs02_00302423 predicted 339
8 SASI_Hs02_00302424 predicted 271
9 SASI_Hs01_00023574 predicted 261
10 SASI_Hs02_00302425 predicted 346
11 SASI_Hs01_00023575 predicted 272
12 SASI_Hs01_00023577 predicted 294
13 SASI_Hs01_00023580 predicted 206
14 SASI_Hs01_00023582 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259969 predicted 224
2 SASI_Rn02_00259970 predicted 300
3 SASI_Rn02_00259971 predicted 280
4 SASI_Rn01_00039679 predicted 362
5 SASI_Rn02_00259972 predicted 212
6 SASI_Rn02_00259973 predicted 228
7 SASI_Rn02_00259974 predicted 303
8 SASI_Rn02_00259975 predicted 222
9 SASI_Rn02_00259976 predicted 327
10 SASI_Rn01_00039680 predicted 347
11 SASI_Rn01_00039681 predicted 496
12 SASI_Rn01_00039682 predicted 515
13 SASI_Rn01_00039683 predicted 511
14 SASI_Rn01_00039684 predicted 140
15 SASI_Rn01_00039685 predicted 91
16 SASI_Rn01_00039686 predicted 562
17 SASI_Rn01_00039687 predicted 550
18 SASI_Rn01_00039688 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076059 predicted 529
2 SASI_Mm01_00076060 predicted 573
3 SASI_Mm01_00076061 predicted 602
4 SASI_Mm01_00076063 predicted 255
5 SASI_Mm02_00322587 predicted 569
6 SASI_Mm02_00322588 predicted 573
7 SASI_Mm01_00076064 predicted 302
8 SASI_Mm01_00076066 predicted 568
9 SASI_Mm01_00076068 predicted 777
10 SASI_Mm02_00322589 predicted 594
11 SASI_Mm01_00076062 predicted 690
12 SASI_Mm01_00076065 predicted 258
13 SASI_Mm01_00076067 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013697
TTR MISSION shRNA Bacterial Glycerol Stock
transthyretin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-120s1c1
Sequence:CCGGCTGATGGTCAAAGTCCTGGATCTCGAGATCCAGGACTTTGACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-319s1c1
Sequence:CCGGACTGGAAGACACTTGGCATTTCTCGAGAAATGCCAAGTGTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-264s1c1
Sequence:CCGGACAGATGAGAAGTTTGTAGAACTCGAGTTCTACAAACTTCTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-99s1c1
Sequence:CCGGGCTGGAGAATCCAAATGTCCTCTCGAGAGGACATTTGGATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-282s1c1
Sequence:CCGGGAAGGAGTGTACAGAGTAGAACTCGAGTTCTACTCTGTACACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013697
TTR MISSION shRNA shRNA Plasmid DNA
transthyretin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-120s1c1
Sequence:CCGGCTGATGGTCAAAGTCCTGGATCTCGAGATCCAGGACTTTGACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-319s1c1
Sequence:CCGGACTGGAAGACACTTGGCATTTCTCGAGAAATGCCAAGTGTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-264s1c1
Sequence:CCGGACAGATGAGAAGTTTGTAGAACTCGAGTTCTACAAACTTCTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-99s1c1
Sequence:CCGGGCTGGAGAATCCAAATGTCCTCTCGAGAGGACATTTGGATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-282s1c1
Sequence:CCGGGAAGGAGTGTACAGAGTAGAACTCGAGTTCTACTCTGTACACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013697
TTR MISSION shRNA Lentiviral Transduction Particles
transthyretin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-120s1c1
Sequence:CCGGCTGATGGTCAAAGTCCTGGATCTCGAGATCCAGGACTTTGACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-319s1c1
Sequence:CCGGACTGGAAGACACTTGGCATTTCTCGAGAAATGCCAAGTGTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-264s1c1
Sequence:CCGGACAGATGAGAAGTTTGTAGAACTCGAGTTCTACAAACTTCTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-99s1c1
Sequence:CCGGGCTGGAGAATCCAAATGTCCTCTCGAGAGGACATTTGGATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013697.1-282s1c1
Sequence:CCGGGAAGGAGTGTACAGAGTAGAACTCGAGTTCTACTCTGTACACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000371
TTR MISSION shRNA Bacterial Glycerol Stock
transthyretin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-117s1c1
Sequence:CCGGCCTCTGATGGTCAAAGTTCTACTCGAGTAGAACTTTGACCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-270s1c1
Sequence:CCGGGAGGAATTTGTAGAAGGGATACTCGAGTATCCCTTCTACAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-293s1c1
Sequence:CCGGCAAAGTGGAAATAGACACCAACTCGAGTTGGTGTCTATTTCCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-258s1c1
Sequence:CCGGCTCACAACTGAGGAGGAATTTCTCGAGAAATTCCTCCTCAGTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000371.3-165s21c1
Sequence:CCGGGCCTTGCTGGACTGGTATTTGCTCGAGCAAATACCAGTCCAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000371.3-461s21c1
Sequence:CCGGGAGCATGCAGAGGTGGTATTCCTCGAGGAATACCACCTCTGCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000371.3-622s21c1
Sequence:CCGGTTTCATGTAACCAAGAGTATTCTCGAGAATACTCTTGGTTACATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000371
TTR MISSION shRNA shRNA Plasmid DNA
transthyretin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-117s1c1
Sequence:CCGGCCTCTGATGGTCAAAGTTCTACTCGAGTAGAACTTTGACCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-270s1c1
Sequence:CCGGGAGGAATTTGTAGAAGGGATACTCGAGTATCCCTTCTACAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-293s1c1
Sequence:CCGGCAAAGTGGAAATAGACACCAACTCGAGTTGGTGTCTATTTCCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-258s1c1
Sequence:CCGGCTCACAACTGAGGAGGAATTTCTCGAGAAATTCCTCCTCAGTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000371.3-165s21c1
Sequence:CCGGGCCTTGCTGGACTGGTATTTGCTCGAGCAAATACCAGTCCAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000371.3-461s21c1
Sequence:CCGGGAGCATGCAGAGGTGGTATTCCTCGAGGAATACCACCTCTGCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000371.3-622s21c1
Sequence:CCGGTTTCATGTAACCAAGAGTATTCTCGAGAATACTCTTGGTTACATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000371
TTR MISSION shRNA Lentiviral Transduction Particles
transthyretin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-117s1c1
Sequence:CCGGCCTCTGATGGTCAAAGTTCTACTCGAGTAGAACTTTGACCATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-270s1c1
Sequence:CCGGGAGGAATTTGTAGAAGGGATACTCGAGTATCCCTTCTACAAATTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-293s1c1
Sequence:CCGGCAAAGTGGAAATAGACACCAACTCGAGTTGGTGTCTATTTCCACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000371.1-258s1c1
Sequence:CCGGCTCACAACTGAGGAGGAATTTCTCGAGAAATTCCTCCTCAGTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000371.3-165s21c1
Sequence:CCGGGCCTTGCTGGACTGGTATTTGCTCGAGCAAATACCAGTCCAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000371.3-461s21c1
Sequence:CCGGGAGCATGCAGAGGTGGTATTCCTCGAGGAATACCACCTCTGCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000371.3-622s21c1
Sequence:CCGGTTTCATGTAACCAAGAGTATTCTCGAGAATACTCTTGGTTACATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks