EMAIL THIS PAGE TO A FRIEND

TTYH1

tweety family member 1

Gene ID:
Human(57348) Summary: This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-independent, volume-sensitive large conductance chloride(-) channel. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jan 2011]
Mouse(57776) tweety homolog 1 (Drosophila)
Rat(292597) tweety homolog 1 (Drosophila)
dog(476386) tweety homolog 1 (Drosophila)
domestic cat(101095059) tweety homolog 1 (Drosophila)
naked mole-rat(101720398) tweety homolog 1 (Drosophila)
Domestic Rabbit(100328780) tweety homolog 1 (Drosophila)
domestic guinea pig(100723246) tweety homolog 1 (Drosophila)
cow(767943) tweety homolog 1 (Drosophila)
sheep(101105273) tweety homolog 1 (Drosophila)
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001005367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005367 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153551 MISSION® esiRNA esiRNA human TTYH1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005367 Rosetta Predictions human pricing
NM_020659 Rosetta Predictions human pricing
NM_001106225 Rosetta Predictions rat pricing
NM_001001454 Rosetta Predictions mouse pricing
NM_001109765 Rosetta Predictions mouse pricing
NM_021324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107010 predicted 805
2 SASI_Hs01_00107011 predicted 969
3 SASI_Hs01_00107012 predicted 972
4 SASI_Hs01_00107013 predicted 814
5 SASI_Hs01_00107014 predicted 392
6 SASI_Hs01_00107015 predicted 401
7 SASI_Hs01_00107016 predicted 913
8 SASI_Hs01_00107017 predicted 800
9 SASI_Hs01_00107018 predicted 1755
10 SASI_Hs01_00107019 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160958 predicted 798
2 SASI_Hs01_00160959 predicted 969
3 SASI_Hs01_00160960 predicted 965
4 SASI_Hs01_00160961 predicted 817
5 SASI_Hs01_00160962 predicted 396
6 SASI_Hs01_00160963 predicted 397
7 SASI_Hs01_00160964 predicted 913
8 SASI_Hs01_00160965 predicted 797
9 SASI_Hs01_00160966 predicted 1797
10 SASI_Hs01_00160967 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216868 predicted 1852
2 SASI_Rn02_00216869 predicted 1782
3 SASI_Rn02_00216870 predicted 1606
4 SASI_Rn02_00216871 predicted 1762
5 SASI_Rn02_00216872 predicted 1680
6 SASI_Rn02_00216873 predicted 966
7 SASI_Rn02_00216874 predicted 1802
8 SASI_Rn02_00216875 predicted 719
9 SASI_Rn02_00216876 predicted 1580
10 SASI_Rn02_00216877 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286153 predicted 1153
2 SASI_Mm01_00063915 predicted 669
3 SASI_Mm02_00286154 predicted 426
4 SASI_Mm02_00286155 predicted 921
5 SASI_Mm02_00286156 predicted 425
6 SASI_Mm01_00063916 predicted 715
7 SASI_Mm02_00286157 predicted 261
8 SASI_Mm02_00286158 predicted 428
9 SASI_Mm02_00286159 predicted 1000
10 SASI_Mm02_00286160 predicted 944
11 SASI_Mm01_00063912 predicted 436
12 SASI_Mm01_00063913 predicted 615
13 SASI_Mm01_00063914 predicted 567
14 SASI_Mm01_00063917 predicted 445
15 SASI_Mm01_00063918 predicted 452
16 SASI_Mm01_00063919 predicted 404
17 SASI_Mm01_00063920 predicted 569
18 SASI_Mm01_00063921 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304354 predicted 1861
2 SASI_Mm02_00304355 predicted 1158
3 SASI_Mm02_00304356 predicted 661
4 SASI_Mm02_00304357 predicted 423
5 SASI_Mm02_00304358 predicted 1788
6 SASI_Mm02_00304359 predicted 260
7 SASI_Mm02_00304360 predicted 1752
8 SASI_Mm02_00304361 predicted 425
9 SASI_Mm02_00304362 predicted 1002
10 SASI_Mm02_00304363 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325880 predicted 1150
2 SASI_Mm01_00108383 predicted 664
3 SASI_Mm02_00325881 predicted 431
4 SASI_Mm02_00325882 predicted 915
5 SASI_Mm02_00325883 predicted 426
6 SASI_Mm01_00108384 predicted 718
7 SASI_Mm02_00325884 predicted 268
8 SASI_Mm02_00325885 predicted 431
9 SASI_Mm02_00325886 predicted 1000
10 SASI_Mm02_00325887 predicted 946
11 SASI_Mm01_00108380 predicted 501
12 SASI_Mm01_00108381 predicted 671
13 SASI_Mm01_00108382 predicted 629
14 SASI_Mm01_00108385 predicted 508
15 SASI_Mm01_00108386 predicted 514
16 SASI_Mm01_00108387 predicted 469
17 SASI_Mm01_00108388 predicted 641
18 SASI_Mm01_00108389 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021324
TTYH1 MISSION shRNA Bacterial Glycerol Stock
tweety family member 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021324.5-2067s1c1
Sequence:CCGGGAGAATAAGCCTAGCACTAAACTCGAGTTTAGTGCTAGGCTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021324.3-1340s1c1
Sequence:CCGGGATGACTACGATGACACAGATCTCGAGATCTGTGTCATCGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-949s1c1
Sequence:CCGGCTCAGACATCCTCAGCTATTACTCGAGTAATAGCTGAGGATGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-379s1c1
Sequence:CCGGCGGCATTGGCATTGGTTTCTACTCGAGTAGAAACCAATGCCAATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-244s1c1
Sequence:CCGGCCTCATCTTCATCGCTGTCTACTCGAGTAGACAGCGATGAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-961s1c1
Sequence:CCGGCAGCTATTATTTCCTGTGCAACTCGAGTTGCACAGGAAATAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021324.3-1124s1c1
Sequence:CCGGGAGACACTGAATGTGACAGAACTCGAGTTCTGTCACATTCAGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200731    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021324.3-2754s1c1
Sequence:CCGGGCAAACACAATGTGCTACTTTCTCGAGAAAGTAGCACATTGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021324
TTYH1 MISSION shRNA shRNA Plasmid DNA
tweety family member 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021324.5-2067s1c1
Sequence:CCGGGAGAATAAGCCTAGCACTAAACTCGAGTTTAGTGCTAGGCTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021324.3-1340s1c1
Sequence:CCGGGATGACTACGATGACACAGATCTCGAGATCTGTGTCATCGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-949s1c1
Sequence:CCGGCTCAGACATCCTCAGCTATTACTCGAGTAATAGCTGAGGATGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-379s1c1
Sequence:CCGGCGGCATTGGCATTGGTTTCTACTCGAGTAGAAACCAATGCCAATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-244s1c1
Sequence:CCGGCCTCATCTTCATCGCTGTCTACTCGAGTAGACAGCGATGAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-961s1c1
Sequence:CCGGCAGCTATTATTTCCTGTGCAACTCGAGTTGCACAGGAAATAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021324.3-1124s1c1
Sequence:CCGGGAGACACTGAATGTGACAGAACTCGAGTTCTGTCACATTCAGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200731    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021324.3-2754s1c1
Sequence:CCGGGCAAACACAATGTGCTACTTTCTCGAGAAAGTAGCACATTGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021324
TTYH1 MISSION shRNA Lentiviral Transduction Particles
tweety family member 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217322    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021324.5-2067s1c1
Sequence:CCGGGAGAATAAGCCTAGCACTAAACTCGAGTTTAGTGCTAGGCTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021324.3-1340s1c1
Sequence:CCGGGATGACTACGATGACACAGATCTCGAGATCTGTGTCATCGTAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-949s1c1
Sequence:CCGGCTCAGACATCCTCAGCTATTACTCGAGTAATAGCTGAGGATGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-379s1c1
Sequence:CCGGCGGCATTGGCATTGGTTTCTACTCGAGTAGAAACCAATGCCAATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-244s1c1
Sequence:CCGGCCTCATCTTCATCGCTGTCTACTCGAGTAGACAGCGATGAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021324.3-961s1c1
Sequence:CCGGCAGCTATTATTTCCTGTGCAACTCGAGTTGCACAGGAAATAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021324.3-1124s1c1
Sequence:CCGGGAGACACTGAATGTGACAGAACTCGAGTTCTGTCACATTCAGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200731    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021324.3-2754s1c1
Sequence:CCGGGCAAACACAATGTGCTACTTTCTCGAGAAAGTAGCACATTGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005367
TTYH1 MISSION shRNA Bacterial Glycerol Stock
tweety family member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-903s1c1
Sequence:CCGGCTCAGTGACTTCTGCTCCAATCTCGAGATTGGAGCAGAAGTCACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-970s1c1
Sequence:CCGGGCTCAGACATCCTGAGCTATTCTCGAGAATAGCTCAGGATGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1154s1c1
Sequence:CCGGGAATGTGACAGAAGGAAATTTCTCGAGAAATTTCCTTCTGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1152s1c1
Sequence:CCGGCTGAATGTGACAGAAGGAAATCTCGAGATTTCCTTCTGTCACATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1146s1c1
Sequence:CCGGGAGACTCTGAATGTGACAGAACTCGAGTTCTGTCACATTCAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-983s1c1
Sequence:CCGGGAGCTATTATCTCCTCTGCAACTCGAGTTGCAGAGGAGATAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1150s1c1
Sequence:CCGGCTCTGAATGTGACAGAAGGAACTCGAGTTCCTTCTGTCACATTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1143s1c1
Sequence:CCGGGAGGAGACTCTGAATGTGACACTCGAGTGTCACATTCAGAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-409s1c1
Sequence:CCGGGCATCGGTTTCTATGGCAACACTCGAGTGTTGCCATAGAAACCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005367.1-1490s1c1
Sequence:CCGGGCTCTGACCACTAACACTCTTCTCGAGAAGAGTGTTAGTGGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005367.1-1759s1c1
Sequence:CCGGGATCTCAACTCGTGGCACTAACTCGAGTTAGTGCCACGAGTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005367
TTYH1 MISSION shRNA shRNA Plasmid DNA
tweety family member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-903s1c1
Sequence:CCGGCTCAGTGACTTCTGCTCCAATCTCGAGATTGGAGCAGAAGTCACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-970s1c1
Sequence:CCGGGCTCAGACATCCTGAGCTATTCTCGAGAATAGCTCAGGATGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1154s1c1
Sequence:CCGGGAATGTGACAGAAGGAAATTTCTCGAGAAATTTCCTTCTGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1152s1c1
Sequence:CCGGCTGAATGTGACAGAAGGAAATCTCGAGATTTCCTTCTGTCACATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1146s1c1
Sequence:CCGGGAGACTCTGAATGTGACAGAACTCGAGTTCTGTCACATTCAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-983s1c1
Sequence:CCGGGAGCTATTATCTCCTCTGCAACTCGAGTTGCAGAGGAGATAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1150s1c1
Sequence:CCGGCTCTGAATGTGACAGAAGGAACTCGAGTTCCTTCTGTCACATTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1143s1c1
Sequence:CCGGGAGGAGACTCTGAATGTGACACTCGAGTGTCACATTCAGAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-409s1c1
Sequence:CCGGGCATCGGTTTCTATGGCAACACTCGAGTGTTGCCATAGAAACCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005367.1-1490s1c1
Sequence:CCGGGCTCTGACCACTAACACTCTTCTCGAGAAGAGTGTTAGTGGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005367.1-1759s1c1
Sequence:CCGGGATCTCAACTCGTGGCACTAACTCGAGTTAGTGCCACGAGTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005367
TTYH1 MISSION shRNA Lentiviral Transduction Particles
tweety family member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-903s1c1
Sequence:CCGGCTCAGTGACTTCTGCTCCAATCTCGAGATTGGAGCAGAAGTCACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-970s1c1
Sequence:CCGGGCTCAGACATCCTGAGCTATTCTCGAGAATAGCTCAGGATGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1154s1c1
Sequence:CCGGGAATGTGACAGAAGGAAATTTCTCGAGAAATTTCCTTCTGTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1152s1c1
Sequence:CCGGCTGAATGTGACAGAAGGAAATCTCGAGATTTCCTTCTGTCACATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1146s1c1
Sequence:CCGGGAGACTCTGAATGTGACAGAACTCGAGTTCTGTCACATTCAGAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-983s1c1
Sequence:CCGGGAGCTATTATCTCCTCTGCAACTCGAGTTGCAGAGGAGATAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1150s1c1
Sequence:CCGGCTCTGAATGTGACAGAAGGAACTCGAGTTCCTTCTGTCACATTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-1143s1c1
Sequence:CCGGGAGGAGACTCTGAATGTGACACTCGAGTGTCACATTCAGAGTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005367.1-409s1c1
Sequence:CCGGGCATCGGTTTCTATGGCAACACTCGAGTGTTGCCATAGAAACCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005367.1-1490s1c1
Sequence:CCGGGCTCTGACCACTAACACTCTTCTCGAGAAGAGTGTTAGTGGTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005367.1-1759s1c1
Sequence:CCGGGATCTCAACTCGTGGCACTAACTCGAGTTAGTGCCACGAGTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks