EMAIL THIS PAGE TO A FRIEND

TTYH2

tweety family member 2

Synonyms: C17orf29
Gene ID:
Human(94015) Summary: This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-activated large conductance chloride(-) channel, and may play a role in kidney tumorigenesis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(117160) tweety homolog 2 (Drosophila)
Rat(287803) tweety homolog 2 (Drosophila)
cow(533184) tweety homolog 2 (Drosophila)
sheep(101106445) tweety homolog 2 (Drosophila)
domestic guinea pig(100714645) tweety homolog 2 (Drosophila)
naked mole-rat(101720369) tweety homolog 2 (Drosophila)
Zebrafish(436763) tweety homolog 2 (Drosophila)
domestic cat(101095532) tweety homolog 2 (Drosophila)
dog(475908) tweety homolog 2 (Drosophila)
chicken(100858879) tweety homolog 2 (Drosophila)
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032646 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026351 MISSION® esiRNA esiRNA human TTYH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032646 Rosetta Predictions human pricing
NM_052869 Rosetta Predictions human pricing
XM_001081641 Rosetta Predictions rat pricing
XM_221081 Rosetta Predictions rat pricing
NM_053273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135038 predicted 2114
2 SASI_Hs01_00135039 predicted 1616
3 SASI_Hs01_00135040 predicted 2012
4 SASI_Hs01_00135041 predicted 1593
5 SASI_Hs01_00135042 predicted 1272
6 SASI_Hs01_00135043 predicted 1569
7 SASI_Hs01_00135044 predicted 2111
8 SASI_Hs01_00135045 predicted 1600
9 SASI_Hs01_00135046 predicted 2081
10 SASI_Hs01_00135047 predicted 1682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161569 predicted 1915
2 SASI_Hs01_00161570 predicted 1427
3 SASI_Hs01_00161571 predicted 1820
4 SASI_Hs01_00161572 predicted 1410
5 SASI_Hs01_00161573 predicted 1082
6 SASI_Hs01_00161574 predicted 1385
7 SASI_Hs01_00161575 predicted 1922
8 SASI_Hs01_00161576 predicted 1411
9 SASI_Hs01_00161577 predicted 1885
10 SASI_Hs01_00161578 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372788 predicted 572
2 SASI_Rn02_00372789 predicted 1114
3 SASI_Rn02_00372790 predicted 948
4 SASI_Rn02_00372791 predicted 1107
5 SASI_Rn02_00372792 predicted 954
6 SASI_Rn02_00372793 predicted 600
7 SASI_Rn02_00372794 predicted 709
8 SASI_Rn02_00372795 predicted 614
9 SASI_Rn02_00372796 predicted 1518
10 SASI_Rn02_00372797 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379804 predicted 2021
2 SASI_Rn02_00379805 predicted 583
3 SASI_Rn02_00379806 predicted 568
4 SASI_Rn02_00379807 predicted 2027
5 SASI_Rn02_00379808 predicted 298
6 SASI_Rn02_00379809 predicted 565
7 SASI_Rn02_00379810 predicted 675
8 SASI_Rn02_00379811 predicted 2027
9 SASI_Rn02_00379812 predicted 2022
10 SASI_Rn02_00379813 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083666 predicted 935
2 SASI_Mm01_00083667 predicted 1133
3 SASI_Mm01_00083668 predicted 1747
4 SASI_Mm01_00083669 predicted 509
5 SASI_Mm01_00083670 predicted 324
6 SASI_Mm01_00083671 predicted 322
7 SASI_Mm01_00083672 predicted 1728
8 SASI_Mm01_00083673 predicted 1335
9 SASI_Mm01_00083674 predicted 1221
10 SASI_Mm01_00083675 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032646
VALIDATED
TTYH2 MISSION shRNA Bacterial Glycerol Stock
tweety family member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.4-430s1c1
Sequence:CCGGCGGAACTACCCAGAAGATGAACTCGAGTTCATCTTCTGGGTAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.4-1447s1c1
Sequence:CCGGCGAGTACATGAACCAAGCCATCTCGAGATGGCTTGGTTCATGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.4-187s1c1
Sequence:CCGGCCTCATCTTCCTTGTGGCTTACTCGAGTAAGCCACAAGGAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.5-1511s1c1
Sequence:CCGGTACGAGAACGTGCCACTAATCCTCGAGGATTAGTGGCACGTTCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032646.5-2419s1c1
Sequence:CCGGAGACACTTTGAAACGACTTTACTCGAGTAAAGTCGTTTCAAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032646
VALIDATED
TTYH2 MISSION shRNA shRNA Plasmid DNA
tweety family member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.4-430s1c1
Sequence:CCGGCGGAACTACCCAGAAGATGAACTCGAGTTCATCTTCTGGGTAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.4-1447s1c1
Sequence:CCGGCGAGTACATGAACCAAGCCATCTCGAGATGGCTTGGTTCATGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.4-187s1c1
Sequence:CCGGCCTCATCTTCCTTGTGGCTTACTCGAGTAAGCCACAAGGAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.5-1511s1c1
Sequence:CCGGTACGAGAACGTGCCACTAATCCTCGAGGATTAGTGGCACGTTCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032646.5-2419s1c1
Sequence:CCGGAGACACTTTGAAACGACTTTACTCGAGTAAAGTCGTTTCAAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032646
VALIDATED
TTYH2 MISSION shRNA Lentiviral Transduction Particles
tweety family member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.4-430s1c1
Sequence:CCGGCGGAACTACCCAGAAGATGAACTCGAGTTCATCTTCTGGGTAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.4-1447s1c1
Sequence:CCGGCGAGTACATGAACCAAGCCATCTCGAGATGGCTTGGTTCATGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.4-187s1c1
Sequence:CCGGCCTCATCTTCCTTGTGGCTTACTCGAGTAAGCCACAAGGAAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032646.5-1511s1c1
Sequence:CCGGTACGAGAACGTGCCACTAATCCTCGAGGATTAGTGGCACGTTCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032646.5-2419s1c1
Sequence:CCGGAGACACTTTGAAACGACTTTACTCGAGTAAAGTCGTTTCAAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053273
VALIDATED
TTYH2 MISSION shRNA Bacterial Glycerol Stock
tweety family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053273.2-1734s1c1
Sequence:CCGGGCTGTGTTTCTGGAATAGAAACTCGAGTTTCTATTCCAGAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053273.2-586s1c1
Sequence:CCGGCCTGAAGTTTATGCAACAGATCTCGAGATCTGTTGCATAAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053273.2-1123s1c1
Sequence:CCGGTCTGCTAAACAACTCCGAGATCTCGAGATCTCGGAGTTGTTTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053273.2-1314s1c1
Sequence:CCGGCCTGGAAATACTTCATCAACACTCGAGTGTTGATGAAGTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053273.2-506s1c1
Sequence:CCGGCAGAGGATGAAGGTAGACCTACTCGAGTAGGTCTACCTTCATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053273
VALIDATED
TTYH2 MISSION shRNA shRNA Plasmid DNA
tweety family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053273.2-1734s1c1
Sequence:CCGGGCTGTGTTTCTGGAATAGAAACTCGAGTTTCTATTCCAGAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053273.2-586s1c1
Sequence:CCGGCCTGAAGTTTATGCAACAGATCTCGAGATCTGTTGCATAAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053273.2-1123s1c1
Sequence:CCGGTCTGCTAAACAACTCCGAGATCTCGAGATCTCGGAGTTGTTTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053273.2-1314s1c1
Sequence:CCGGCCTGGAAATACTTCATCAACACTCGAGTGTTGATGAAGTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053273.2-506s1c1
Sequence:CCGGCAGAGGATGAAGGTAGACCTACTCGAGTAGGTCTACCTTCATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053273
VALIDATED
TTYH2 MISSION shRNA Lentiviral Transduction Particles
tweety family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053273.2-1734s1c1
Sequence:CCGGGCTGTGTTTCTGGAATAGAAACTCGAGTTTCTATTCCAGAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053273.2-586s1c1
Sequence:CCGGCCTGAAGTTTATGCAACAGATCTCGAGATCTGTTGCATAAACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053273.2-1123s1c1
Sequence:CCGGTCTGCTAAACAACTCCGAGATCTCGAGATCTCGGAGTTGTTTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_053273.2-1314s1c1
Sequence:CCGGCCTGGAAATACTTCATCAACACTCGAGTGTTGATGAAGTATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053273.2-506s1c1
Sequence:CCGGCAGAGGATGAAGGTAGACCTACTCGAGTAGGTCTACCTTCATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks