EMAIL THIS PAGE TO A FRIEND

TTYH3

tweety family member 3

UniProtKB ID: Q9C0H2, A4D201, B7WP98, Q6L749, Q6ZVG3, Q8TEG6
Gene ID:
Human(80727) Summary: This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-activated large conductance chloride(-) channel. [provided by RefSeq, Jul 2008]
Mouse(78339) tweety homolog 3 (Drosophila)
Rat(304315) tweety homolog 3 (Drosophila)
chicken(416470) tweety homolog 3 (Drosophila)
domestic cat(101092571) tweety homolog 3 (Drosophila)
dog(489890) tweety homolog 3 (Drosophila)
naked mole-rat(101699163) tweety homolog 3 (Drosophila)
domestic guinea pig(100731932) tweety homolog 3 (Drosophila)
cow(512271) tweety homolog 3 (Drosophila)
sheep(101112110) tweety homolog 3 (Drosophila)
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025250 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025250 Rosetta Predictions human pricing
NM_001107124 Rosetta Predictions rat pricing
NM_175274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151238 predicted 1612
2 SASI_Hs01_00151239 predicted 2029
3 SASI_Hs01_00151240 predicted 987
4 SASI_Hs01_00151241 predicted 512
5 SASI_Hs01_00151242 predicted 1374
6 SASI_Hs01_00151243 predicted 1492
7 SASI_Hs02_00358083 predicted 1026
8 SASI_Hs01_00151244 predicted 1121
9 SASI_Hs01_00151246 predicted 1952
10 SASI_Hs02_00358084 predicted 1596
11 SASI_Hs01_00151245 predicted 925
12 SASI_Hs01_00151247 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225736 predicted 276
2 SASI_Rn02_00225737 predicted 826
3 SASI_Rn02_00225738 predicted 654
4 SASI_Rn02_00225739 predicted 954
5 SASI_Rn02_00225740 predicted 863
6 SASI_Rn02_00225741 predicted 1225
7 SASI_Rn02_00225742 predicted 1160
8 SASI_Rn02_00225743 predicted 1117
9 SASI_Rn02_00225744 predicted 582
10 SASI_Rn02_00225745 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026978 predicted 491
2 SASI_Mm01_00026979 predicted 1232
3 SASI_Mm01_00026980 predicted 413
4 SASI_Mm01_00026981 predicted 931
5 SASI_Mm01_00026982 predicted 353
6 SASI_Mm01_00026983 predicted 1609
7 SASI_Mm02_00345998 predicted 357
8 SASI_Mm02_00345999 predicted 493
9 SASI_Mm01_00026984 predicted 1344
10 SASI_Mm01_00026985 predicted 1497
11 SASI_Mm01_00026977 predicted 1153
12 SASI_Mm01_00026986 predicted 1518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025250
VALIDATED
TTYH3 MISSION shRNA Bacterial Glycerol Stock
tweety family member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025250.2-516s21c1
Sequence:CCGGAGACCAGTGATGGCATCCATACTCGAGTATGGATGCCATCACTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025250.2-2039s21c1
Sequence:CCGGAGATGGTCGCCGCACCTACAACTCGAGTTGTAGGTGCGGCGACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025250.2-486s21c1
Sequence:CCGGGCATCGCAGTGGGATTCTACGCTCGAGCGTAGAATCCCACTGCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025250.2-1609s1c1
Sequence:CCGGCATGAGCCAGAACGCTAATTTCTCGAGAAATTAGCGTTCTGGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025250.2-1606s1c1
Sequence:CCGGGTACATGAGCCAGAACGCTAACTCGAGTTAGCGTTCTGGCTCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025250.2-3939s1c1
Sequence:CCGGCGCCTGCCATTGGTTGTATTTCTCGAGAAATACAACCAATGGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025250.2-3979s1c1
Sequence:CCGGCCGTGTTCCTAACTACTCCATCTCGAGATGGAGTAGTTAGGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025250.2-1136s1c1
Sequence:CCGGGCACTGGTGGAGATGCAGGATCTCGAGATCCTGCATCTCCACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025250
VALIDATED
TTYH3 MISSION shRNA shRNA Plasmid DNA
tweety family member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025250.2-516s21c1
Sequence:CCGGAGACCAGTGATGGCATCCATACTCGAGTATGGATGCCATCACTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025250.2-2039s21c1
Sequence:CCGGAGATGGTCGCCGCACCTACAACTCGAGTTGTAGGTGCGGCGACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025250.2-486s21c1
Sequence:CCGGGCATCGCAGTGGGATTCTACGCTCGAGCGTAGAATCCCACTGCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025250.2-1609s1c1
Sequence:CCGGCATGAGCCAGAACGCTAATTTCTCGAGAAATTAGCGTTCTGGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025250.2-1606s1c1
Sequence:CCGGGTACATGAGCCAGAACGCTAACTCGAGTTAGCGTTCTGGCTCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025250.2-3939s1c1
Sequence:CCGGCGCCTGCCATTGGTTGTATTTCTCGAGAAATACAACCAATGGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025250.2-3979s1c1
Sequence:CCGGCCGTGTTCCTAACTACTCCATCTCGAGATGGAGTAGTTAGGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025250.2-1136s1c1
Sequence:CCGGGCACTGGTGGAGATGCAGGATCTCGAGATCCTGCATCTCCACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025250
VALIDATED
TTYH3 MISSION shRNA Lentiviral Transduction Particles
tweety family member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025250.2-516s21c1
Sequence:CCGGAGACCAGTGATGGCATCCATACTCGAGTATGGATGCCATCACTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025250.2-2039s21c1
Sequence:CCGGAGATGGTCGCCGCACCTACAACTCGAGTTGTAGGTGCGGCGACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025250.2-486s21c1
Sequence:CCGGGCATCGCAGTGGGATTCTACGCTCGAGCGTAGAATCCCACTGCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025250.2-1609s1c1
Sequence:CCGGCATGAGCCAGAACGCTAATTTCTCGAGAAATTAGCGTTCTGGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025250.2-1606s1c1
Sequence:CCGGGTACATGAGCCAGAACGCTAACTCGAGTTAGCGTTCTGGCTCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_025250.2-3939s1c1
Sequence:CCGGCGCCTGCCATTGGTTGTATTTCTCGAGAAATACAACCAATGGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025250.2-3979s1c1
Sequence:CCGGCCGTGTTCCTAACTACTCCATCTCGAGATGGAGTAGTTAGGAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025250.2-1136s1c1
Sequence:CCGGGCACTGGTGGAGATGCAGGATCTCGAGATCCTGCATCTCCACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175274
TTYH3 MISSION shRNA Bacterial Glycerol Stock
tweety family member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-1245s1c1
Sequence:CCGGGCTAAATGGAACGGAAGTGAACTCGAGTTCACTTCCGTTCCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-843s1c1
Sequence:CCGGCCTGCTCTTGCTTGATGTTATCTCGAGATAACATCAAGCAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-550s1c1
Sequence:CCGGGCCACCTACTCACTACGCCATCTCGAGATGGCGTAGTGAGTAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-1150s1c1
Sequence:CCGGCTGGTGGAAATGCAAGATGTTCTCGAGAACATCTTGCATTTCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175274.2-2281s1c1
Sequence:CCGGCCCTTCATACTCTCTGGTCTTCTCGAGAAGACCAGAGAGTATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175274
TTYH3 MISSION shRNA shRNA Plasmid DNA
tweety family member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-1245s1c1
Sequence:CCGGGCTAAATGGAACGGAAGTGAACTCGAGTTCACTTCCGTTCCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-843s1c1
Sequence:CCGGCCTGCTCTTGCTTGATGTTATCTCGAGATAACATCAAGCAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-550s1c1
Sequence:CCGGGCCACCTACTCACTACGCCATCTCGAGATGGCGTAGTGAGTAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-1150s1c1
Sequence:CCGGCTGGTGGAAATGCAAGATGTTCTCGAGAACATCTTGCATTTCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175274.2-2281s1c1
Sequence:CCGGCCCTTCATACTCTCTGGTCTTCTCGAGAAGACCAGAGAGTATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175274
TTYH3 MISSION shRNA Lentiviral Transduction Particles
tweety family member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-1245s1c1
Sequence:CCGGGCTAAATGGAACGGAAGTGAACTCGAGTTCACTTCCGTTCCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-843s1c1
Sequence:CCGGCCTGCTCTTGCTTGATGTTATCTCGAGATAACATCAAGCAAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-550s1c1
Sequence:CCGGGCCACCTACTCACTACGCCATCTCGAGATGGCGTAGTGAGTAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175274.2-1150s1c1
Sequence:CCGGCTGGTGGAAATGCAAGATGTTCTCGAGAACATCTTGCATTTCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175274.2-2281s1c1
Sequence:CCGGCCCTTCATACTCTCTGGTCTTCTCGAGAAGACCAGAGAGTATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks