EMAIL THIS PAGE TO A FRIEND

TUB

tubby bipartite transcription factor

Synonyms: rd5
UniProtKB ID: P50607, D3DQU4, O00293, Q6B007
Gene ID:
Human(7275) Summary: This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(22141) tubby candidate gene
Rat(25609) tubby homolog (mouse)
dog(485377) tubby homolog (mouse)
Horse(100070898) tubby homolog (mouse)
domestic cat(101089894) tubby homolog (mouse)
Zebrafish(568677) tubby homolog (mouse)
chicken(423061) tubby homolog (mouse)
cow(539051) tubby homolog (mouse)
sheep(101108683) tubby homolog (mouse)
cow(280949) tubby homolog (mouse)
domestic guinea pig(100732995) tubby homolog (mouse)
naked mole-rat(101720190) tubby homolog (mouse)
Domestic Rabbit(100342264) tubby homolog (mouse)
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003320 Rosetta Predictions human pricing
NM_177972 Rosetta Predictions human pricing
NM_013077 Rosetta Predictions rat pricing
NM_021885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238335 predicted 1790
2 SASI_Hs02_00335453 predicted 1657
3 SASI_Hs01_00238337 predicted 1555
4 SASI_Hs01_00238339 predicted 1576
5 SASI_Hs02_00335454 predicted 1283
6 SASI_Hs01_00238341 predicted 1832
7 SASI_Hs01_00238342 predicted 1716
8 SASI_Hs01_00238343 predicted 1521
9 SASI_Hs02_00335455 predicted 1804
10 SASI_Hs02_00335456 predicted 1842
11 SASI_Hs01_00238336 predicted 1432
12 SASI_Hs01_00238338 predicted 1421
13 SASI_Hs01_00238340 predicted 1333
14 SASI_Hs01_00238344 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221332 predicted 1530
2 SASI_Hs02_00369445 predicted 1404
3 SASI_Hs01_00221334 predicted 1304
4 SASI_Hs01_00221336 predicted 1315
5 SASI_Hs01_00221338 predicted 1021
6 SASI_Hs01_00221339 predicted 1576
7 SASI_Hs01_00221340 predicted 1456
8 SASI_Hs01_00221341 predicted 1265
9 SASI_Hs02_00369446 predicted 1548
10 SASI_Hs02_00369447 predicted 1592
11 SASI_Hs01_00221333 predicted 1171
12 SASI_Hs01_00221335 predicted 1169
13 SASI_Hs01_00221337 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072007 predicted 1045
2 SASI_Rn01_00072008 predicted 724
3 SASI_Rn01_00072010 predicted 840
4 SASI_Rn01_00072011 predicted 1237
5 SASI_Rn01_00072012 predicted 990
6 SASI_Rn02_00260840 predicted 1147
7 SASI_Rn01_00072013 predicted 259
8 SASI_Rn01_00072014 predicted 1016
9 SASI_Rn01_00072015 predicted 1010
10 SASI_Rn01_00072016 predicted 1165
11 SASI_Rn01_00072009 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197313 predicted 244
2 SASI_Mm01_00197314 predicted 1233
3 SASI_Mm01_00197315 predicted 867
4 SASI_Mm01_00197316 predicted 1062
5 SASI_Mm02_00326447 predicted 1380
6 SASI_Mm01_00197317 predicted 1139
7 SASI_Mm01_00197318 predicted 955
8 SASI_Mm01_00197319 predicted 1614
9 SASI_Mm01_00197320 predicted 800
10 SASI_Mm01_00197321 predicted 1645
11 SASI_Mm01_00197322 predicted 1092
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177972
VALIDATED
TUB MISSION shRNA Bacterial Glycerol Stock
tubby bipartite transcription factor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-2337s1c1
Sequence:CCGGGCATTTGATTTCTCCAGGTTTCTCGAGAAACCTGGAGAAATCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-5013s1c1
Sequence:CCGGGCAGGACATTTACCTCTTAAACTCGAGTTTAAGAGGTAAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-1394s1c1
Sequence:CCGGGAATAAGAACACGGAGAGTATCTCGAGATACTCTCCGTGTTCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-2336s1c1
Sequence:CCGGCGCATTTGATTTCTCCAGGTTCTCGAGAACCTGGAGAAATCAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177972.1-1445s1c1
Sequence:CCGGGAATGATGACACACAGTCCTACTCGAGTAGGACTGTGTGTCATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177972
VALIDATED
TUB MISSION shRNA shRNA Plasmid DNA
tubby bipartite transcription factor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-2337s1c1
Sequence:CCGGGCATTTGATTTCTCCAGGTTTCTCGAGAAACCTGGAGAAATCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-5013s1c1
Sequence:CCGGGCAGGACATTTACCTCTTAAACTCGAGTTTAAGAGGTAAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-1394s1c1
Sequence:CCGGGAATAAGAACACGGAGAGTATCTCGAGATACTCTCCGTGTTCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-2336s1c1
Sequence:CCGGCGCATTTGATTTCTCCAGGTTCTCGAGAACCTGGAGAAATCAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177972.1-1445s1c1
Sequence:CCGGGAATGATGACACACAGTCCTACTCGAGTAGGACTGTGTGTCATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177972
VALIDATED
TUB MISSION shRNA Lentiviral Transduction Particles
tubby bipartite transcription factor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-2337s1c1
Sequence:CCGGGCATTTGATTTCTCCAGGTTTCTCGAGAAACCTGGAGAAATCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-5013s1c1
Sequence:CCGGGCAGGACATTTACCTCTTAAACTCGAGTTTAAGAGGTAAATGTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-1394s1c1
Sequence:CCGGGAATAAGAACACGGAGAGTATCTCGAGATACTCTCCGTGTTCTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_177972.1-2336s1c1
Sequence:CCGGCGCATTTGATTTCTCCAGGTTCTCGAGAACCTGGAGAAATCAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177972.1-1445s1c1
Sequence:CCGGGAATGATGACACACAGTCCTACTCGAGTAGGACTGTGTGTCATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021885
TUB MISSION shRNA Bacterial Glycerol Stock
tubby bipartite transcription factor
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021885.2-2128s1c1
Sequence:CCGGGCACTCAAGCTGTATGTAGAACTCGAGTTCTACATACAGCTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-1180s1c1
Sequence:CCGGGCGATAGCTATATCGGGAAATCTCGAGATTTCCCGATATAGCTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-1232s1c1
Sequence:CCGGCGTTTATGACAATGGCGTCAACTCGAGTTGACGCCATTGTCATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-240s1c1
Sequence:CCGGCCTTACAGTGTCCTAGATGATCTCGAGATCATCTAGGACACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-1374s1c1
Sequence:CCGGCCAGGCATGAACATGGTTCATCTCGAGATGAACCATGTTCATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021885.4-1323s21c1
Sequence:CCGGGCGGTGTGCTATGAGACAAATCTCGAGATTTGTCTCATAGCACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021885.4-598s21c1
Sequence:CCGGAGAAGAAGGGAAAGCATAAAGCTCGAGCTTTATGCTTTCCCTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021885
TUB MISSION shRNA shRNA Plasmid DNA
tubby bipartite transcription factor
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021885.2-2128s1c1
Sequence:CCGGGCACTCAAGCTGTATGTAGAACTCGAGTTCTACATACAGCTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-1180s1c1
Sequence:CCGGGCGATAGCTATATCGGGAAATCTCGAGATTTCCCGATATAGCTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-1232s1c1
Sequence:CCGGCGTTTATGACAATGGCGTCAACTCGAGTTGACGCCATTGTCATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-240s1c1
Sequence:CCGGCCTTACAGTGTCCTAGATGATCTCGAGATCATCTAGGACACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-1374s1c1
Sequence:CCGGCCAGGCATGAACATGGTTCATCTCGAGATGAACCATGTTCATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021885.4-1323s21c1
Sequence:CCGGGCGGTGTGCTATGAGACAAATCTCGAGATTTGTCTCATAGCACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021885.4-598s21c1
Sequence:CCGGAGAAGAAGGGAAAGCATAAAGCTCGAGCTTTATGCTTTCCCTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021885
TUB MISSION shRNA Lentiviral Transduction Particles
tubby bipartite transcription factor
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021885.2-2128s1c1
Sequence:CCGGGCACTCAAGCTGTATGTAGAACTCGAGTTCTACATACAGCTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-1180s1c1
Sequence:CCGGGCGATAGCTATATCGGGAAATCTCGAGATTTCCCGATATAGCTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-1232s1c1
Sequence:CCGGCGTTTATGACAATGGCGTCAACTCGAGTTGACGCCATTGTCATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-240s1c1
Sequence:CCGGCCTTACAGTGTCCTAGATGATCTCGAGATCATCTAGGACACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021885.2-1374s1c1
Sequence:CCGGCCAGGCATGAACATGGTTCATCTCGAGATGAACCATGTTCATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021885.4-1323s21c1
Sequence:CCGGGCGGTGTGCTATGAGACAAATCTCGAGATTTGTCTCATAGCACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021885.4-598s21c1
Sequence:CCGGAGAAGAAGGGAAAGCATAAAGCTCGAGCTTTATGCTTTCCCTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks