EMAIL THIS PAGE TO A FRIEND

TUBA1A

tubulin, alpha 1a

Synonyms: B-ALPHA-1 LIS3 TUBA3
UniProtKB ID: Q71U36, A8K0B8, G3V1U9, P04687, P05209
Gene ID:
Human(7846) Summary: Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulins. The genes encoding these microtubule constituents belong to the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and is highly similar to the mouse and rat Tuba1 genes. Northern blotting studies have shown that the gene expression is predominantly found in morphologically differentiated neurologic cells. This gene is one of three alpha-tubulin genes in a cluster on chromosome 12q. Mutations in this gene cause lissencephaly type 3 (LIS3) - a neurological condition characterized by microcephaly, mental retardation, and early-onset epilepsy and caused by defective neuronal migration. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
Mouse(22142) tubulin, alpha 1A
Rat(64158) tubulin, alpha 1A
cow(404053) tubulin, alpha 1a
domestic guinea pig(100726777) tubulin, alpha 1a
Horse(100051840) tubulin, alpha 1a
dog(608147) tubulin, alpha 1a
domestic cat(101096902) tubulin, alpha 1a
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
T6199 Anti-α-Tubulin antibody, Mouse monoclonal clone DM1A, purified from hybridoma cell culture yeast, human, chicken, rat, amphibian, fungi, bovine, mouse
immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing
T8203 Anti-α-Tubulin antibody, Mouse monoclonal clone AA13, purified from hybridoma cell culture rat, human, mouse
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB3500023 Anti-α-Tubulin from chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
F2168 Anti-α-Tubulin−FITC antibody, Mouse monoclonal clone DM1A, purified from hybridoma cell culture yeast, human, chicken, rat, amphibian, fungi, bovine, mouse
immunofluorescence pricing
SAB3501071 Anti-ALPHA-TUBULIN antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB3501072 Anti-ALPHA-TUBULIN antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504761 Anti-phospho-TUBA1/3/4 (pTyr272) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
HPA039247 Anti-TUBA1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA043684 Anti-TUBA1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4500087 Anti-Tubulin α, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
T6074 Monoclonal Anti-α-Tubulin antibody produced in mouse clone B-5-1-2, purified immunoglobulin, buffered aqueous solution human, Chlamydomonas, African green monkey, chicken, mouse, bovine, rat, kangaroo rat, sea urchin
immunocytochemistry, immunoprecipitation, microarray, western blot pricing
T5168 Monoclonal Anti-α-Tubulin antibody produced in mouse ascites fluid, clone B-5-1-2 human, Chlamydomonas, African green monkey, chicken, mouse, bovine, rat, kangaroo rat, sea urchin
immunofluorescence, radioimmunoassay, western blot pricing
T9026 Monoclonal Anti-α-Tubulin antibody produced in mouse clone DM1A, ascites fluid yeast, human, chicken, rat, amphibian, fungi, bovine, mouse
immunofluorescence, western blot pricing
T7451 Monoclonal Anti-Acetylated Tubulin antibody produced in mouse clone 6-11B-1, purified from hybridoma cell culture monkey, protista, mouse, pig, human, bovine, invertebrates, rat, hamster, plant, frog, chicken
dot blot, electron microscopy, immunohistochemistry, radioimmunoassay, western blot pricing
SAB1402410 Monoclonal Anti-TUBA3, (C-terminal) antibody produced in mouse clone 2D2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
T6793 Monoclonal Anti-Tubulin, Acetylated antibody produced in mouse clone 6-11B-1, ascites fluid plant, human, pig, monkey, invertebrates, hamster, bovine, chicken, rat, frog, protista, mouse
dot blot, electron microscopy, ELISA, immunocytochemistry, radioimmunoassay, western blot pricing
T9822 Monoclonal Anti-Tubulin, Polyglutamylated antibody produced in mouse clone B3, purified from hybridoma cell culture mouse, Oxyrrhis marina (dinoflagellate), sea urchin (Lytechinus pictus and three others.), chicken, human, bovine, rabbit, rat, monkey
ELISA, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006009 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU194301 MISSION® esiRNA esiRNA targeting mouse Tuba1a mouse pricing

Related Products

Product # Description Species Add to Cart
 
ABT241 Anti-acetyl Tubulin (Lys40) Antibody 100 µg, Anti-acetyl Tubulin (Lys40) Antibody is an antibody against acetyl Tubulin (Lys40) for use in western blotting. pricing
ABT170 Anti-alpha Tubulin Antibody, nontyrosinated 100 µL, Detect Tubulin using this rabbit polyclonal antibody, Anti-alpha Tubulin Antibody, nontyrosinated validated for use in western blotting, ELISA & ICC. pricing
ABT171 Anti-alpha Tubulin Antibody, tyrosinated 100 µL, Detect Tubulin using this rabbit polyclonal antibody, Anti-alpha Tubulin Antibody, tyrosinated validated for use in western blotting, ELISA & ICC. pricing
MAB1864-I Anti-alpha-Tubulin Antibody, tyrosinated, clone YL1/2 100 μg, This Anti-alpha-Tubulin Antibody, tyrosinated, clone YL1/2 is validated for use in Western Blotting, Immunocytochemistry, Immunohistochemistry, Electron Microscopy, ELISA and Radioimmunoassay for the detection of alpha-Tubulin. pricing
05-829X-555 Anti-α-Tubulin Antibody, Alexa Fluor® 555 conjugate 100 µg, Anti-α-Tubulin Antibody, Alexa Fluor 555 conjugate detects level of α-Tubulin & has been published & validated for use in IF. pricing
05-829 Anti-α-Tubulin Antibody, clone DM1A 200 µg, Anti-α-Tubulin Antibody, clone DM1A is an antibody against α-Tubulin for use in IC, IF & WB. pricing
16-232 Anti-α-Tubulin Antibody, clone DM1A, Alexa Fluor® 488 conjugate 100 µg, Anti-α-Tubulin Antibody, clone DM1A, Alexa Fluor 488 conjugate is an antibody against α-Tubulin for use in FC, IC, IF & WB. pricing
MAB5566 Anti-Tubulin α Antibody, detyrosinated 100 µL, This Anti-Tubulin Antibody, α, detyrosinated is validated for use in WB for the detection of Tubulin. pricing
FCMAB322PE Milli-Mark™ Anti-alpha-Tubulin-PE Antibody, clone DM1A 100 tests, Detect alpha-Tubulin using this Milli-Mark Anti-alpha-Tubulin-PE Antibody, clone DM1A validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006009 Rosetta Predictions human pricing
NM_022298 Rosetta Predictions rat pricing
NM_011653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230785 predicted 746
2 SASI_Hs02_00340719 predicted 1435
3 SASI_Hs01_00230786 predicted 792
4 SASI_Hs01_00230787 predicted 754
5 SASI_Hs01_00230788 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090867 predicted 902
2 SASI_Rn02_00263116 predicted 897
3 SASI_Rn02_00263117 predicted 916
4 SASI_Rn02_00263118 predicted 803
5 SASI_Rn02_00263119 predicted 803
6 SASI_Rn02_00263120 predicted 988
7 SASI_Rn02_00263121 predicted 1108
8 SASI_Rn02_00263122 predicted 916
9 SASI_Rn02_00263123 predicted 214
10 SASI_Rn01_00090868 predicted 738
11 SASI_Rn01_00090869 predicted 733
12 SASI_Rn01_00090870 predicted 755
13 SASI_Rn01_00090871 predicted 711
14 SASI_Rn01_00090872 predicted 691
15 SASI_Rn01_00090873 predicted 1409
16 SASI_Rn01_00090874 predicted 1518
17 SASI_Rn01_00090875 predicted 1449
18 SASI_Rn01_00090876 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321143 predicted 730
2 SASI_Mm01_00140408 predicted 710
3 SASI_Mm01_00140409 predicted 713
4 SASI_Mm02_00321144 predicted 1058
5 SASI_Mm02_00321145 predicted 1466
6 SASI_Mm02_00321146 predicted 1461
7 SASI_Mm01_00140412 predicted 1486
8 SASI_Mm01_00140413 predicted 1435
9 SASI_Mm01_00140414 predicted 1389
10 SASI_Mm01_00140415 predicted 1492
11 SASI_Mm01_00140407 predicted 730
12 SASI_Mm01_00140410 predicted 1466
13 SASI_Mm01_00140411 predicted 1468
14 SASI_Mm01_00140416 predicted 1432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006009
VALIDATED
TUBA1A MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 1a
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006009.2-763s21c1
Sequence:CCGGCCAACCTATACTAACCTGAATCTCGAGATTCAGGTTAGTATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006009.2-368s21c1
Sequence:CCGGAGCAACTTATCACAGGCAAAGCTCGAGCTTTGCCTGTGATAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006009.2-1484s21c1
Sequence:CCGGTACAGGGAAGCTTATTCTGTTCTCGAGAACAGAATAAGCTTCCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006009.2-782s21c1
Sequence:CCGGATAGGTTAATAGGTCAAATTGCTCGAGCAATTTGACCTATTAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006009.2-752s21c1
Sequence:CCGGATATTGAGCGTCCAACCTATACTCGAGTATAGGTTGGACGCTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-777s1c1
Sequence:CCGGCCTGAATAGGTTAATAGGTCACTCGAGTGACCTATTAACCTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-383s1c1
Sequence:CCGGGCAAAGAAGATGCTGCCAATACTCGAGTATTGGCAGCATCTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-764s1c1
Sequence:CCGGCAACCTATACTAACCTGAATACTCGAGTATTCAGGTTAGTATAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-763s1c1
Sequence:CCGGCCAACCTATACTAACCTGAATCTCGAGATTCAGGTTAGTATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-1463s1c1
Sequence:CCGGACGTCACAAAGGTGCTGCTTTCTCGAGAAAGCAGCACCTTTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006009
VALIDATED
TUBA1A MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 1a
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006009.2-763s21c1
Sequence:CCGGCCAACCTATACTAACCTGAATCTCGAGATTCAGGTTAGTATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006009.2-368s21c1
Sequence:CCGGAGCAACTTATCACAGGCAAAGCTCGAGCTTTGCCTGTGATAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006009.2-1484s21c1
Sequence:CCGGTACAGGGAAGCTTATTCTGTTCTCGAGAACAGAATAAGCTTCCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006009.2-782s21c1
Sequence:CCGGATAGGTTAATAGGTCAAATTGCTCGAGCAATTTGACCTATTAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006009.2-752s21c1
Sequence:CCGGATATTGAGCGTCCAACCTATACTCGAGTATAGGTTGGACGCTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-777s1c1
Sequence:CCGGCCTGAATAGGTTAATAGGTCACTCGAGTGACCTATTAACCTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-383s1c1
Sequence:CCGGGCAAAGAAGATGCTGCCAATACTCGAGTATTGGCAGCATCTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-764s1c1
Sequence:CCGGCAACCTATACTAACCTGAATACTCGAGTATTCAGGTTAGTATAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-763s1c1
Sequence:CCGGCCAACCTATACTAACCTGAATCTCGAGATTCAGGTTAGTATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-1463s1c1
Sequence:CCGGACGTCACAAAGGTGCTGCTTTCTCGAGAAAGCAGCACCTTTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006009
VALIDATED
TUBA1A MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 1a
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006009.2-763s21c1
Sequence:CCGGCCAACCTATACTAACCTGAATCTCGAGATTCAGGTTAGTATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006009.2-368s21c1
Sequence:CCGGAGCAACTTATCACAGGCAAAGCTCGAGCTTTGCCTGTGATAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006009.2-1484s21c1
Sequence:CCGGTACAGGGAAGCTTATTCTGTTCTCGAGAACAGAATAAGCTTCCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006009.2-782s21c1
Sequence:CCGGATAGGTTAATAGGTCAAATTGCTCGAGCAATTTGACCTATTAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006009.2-752s21c1
Sequence:CCGGATATTGAGCGTCCAACCTATACTCGAGTATAGGTTGGACGCTCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-777s1c1
Sequence:CCGGCCTGAATAGGTTAATAGGTCACTCGAGTGACCTATTAACCTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-383s1c1
Sequence:CCGGGCAAAGAAGATGCTGCCAATACTCGAGTATTGGCAGCATCTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-764s1c1
Sequence:CCGGCAACCTATACTAACCTGAATACTCGAGTATTCAGGTTAGTATAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-763s1c1
Sequence:CCGGCCAACCTATACTAACCTGAATCTCGAGATTCAGGTTAGTATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006009.2-1463s1c1
Sequence:CCGGACGTCACAAAGGTGCTGCTTTCTCGAGAAAGCAGCACCTTTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011653
VALIDATED
TUBA1A MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 1a
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011653.1-868s1c1
Sequence:CCGGCCTGTCATCTCTGCTGAGAAACTCGAGTTTCTCAGCAGAGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011653.1-711s1c1
Sequence:CCGGCCCAACCTACACTAACCTAAACTCGAGTTTAGGTTAGTGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011653.1-1324s1c1
Sequence:CCGGGCTGCCCTAGAGAAGGATTATCTCGAGATAATCCTTCTCTAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011653.1-1430s1c1
Sequence:CCGGCACAGGGATGTTTATTGTGTTCTCGAGAACACAATAAACATCCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011653.1-332s1c1
Sequence:CCGGGCAAGGAGGATGCTGCCAATACTCGAGTATTGGCAGCATCCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011653
VALIDATED
TUBA1A MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 1a
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011653.1-868s1c1
Sequence:CCGGCCTGTCATCTCTGCTGAGAAACTCGAGTTTCTCAGCAGAGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011653.1-711s1c1
Sequence:CCGGCCCAACCTACACTAACCTAAACTCGAGTTTAGGTTAGTGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011653.1-1324s1c1
Sequence:CCGGGCTGCCCTAGAGAAGGATTATCTCGAGATAATCCTTCTCTAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011653.1-1430s1c1
Sequence:CCGGCACAGGGATGTTTATTGTGTTCTCGAGAACACAATAAACATCCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011653.1-332s1c1
Sequence:CCGGGCAAGGAGGATGCTGCCAATACTCGAGTATTGGCAGCATCCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011653
VALIDATED
TUBA1A MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 1a
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011653.1-868s1c1
Sequence:CCGGCCTGTCATCTCTGCTGAGAAACTCGAGTTTCTCAGCAGAGATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011653.1-711s1c1
Sequence:CCGGCCCAACCTACACTAACCTAAACTCGAGTTTAGGTTAGTGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011653.1-1324s1c1
Sequence:CCGGGCTGCCCTAGAGAAGGATTATCTCGAGATAATCCTTCTCTAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011653.1-1430s1c1
Sequence:CCGGCACAGGGATGTTTATTGTGTTCTCGAGAACACAATAAACATCCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011653.1-332s1c1
Sequence:CCGGGCAAGGAGGATGCTGCCAATACTCGAGTATTGGCAGCATCCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks