EMAIL THIS PAGE TO A FRIEND

TUBA1B

tubulin, alpha 1b

Synonyms: K-ALPHA-1
UniProtKB ID: P68363, P04687, P05209, Q27I68
Gene ID:
Mouse(22143) tubulin, alpha 1B
Rat(500929) tubulin, alpha 1B
Zebrafish(373080) tubulin, alpha 1b
Horse(100059285) tubulin, alpha 1b
domestic cat(101096402) tubulin, alpha 1b
dog(608864) tubulin, alpha 1b
domestic guinea pig(100716481) tubulin, alpha 1b
cow(539882) tubulin, alpha 1b
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504761 Anti-phospho-TUBA1/3/4 (pTyr272) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB2701846 Anti-tuba1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701847 Anti-tuba1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701729 Anti-tuba1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB1401521 Anti-TUBA1B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA063394 Anti-TUBA3D antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
T3526 Anti-Tubulin antibody produced in rabbit whole antiserum mouse, chicken
immunofluorescence, western blot pricing
WH0010376M1 Monoclonal Anti-K-ALPHA-1 antibody produced in mouse clone 4D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404816 Monoclonal Anti-TUBA1B antibody produced in mouse clone 2E8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006082 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU194791 MISSION® esiRNA esiRNA targeting mouse Tuba1b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006082 Rosetta Predictions human pricing
NM_001044270 Rosetta Predictions rat pricing
XM_576339 Rosetta Predictions rat pricing
NM_011654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081386 predicted 673
2 SASI_Hs02_00340854 predicted 877
3 SASI_Hs01_00081387 predicted 1564
4 SASI_Hs01_00081388 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205374 predicted 945
2 SASI_Rn02_00205375 predicted 929
3 SASI_Rn02_00205376 predicted 779
4 SASI_Rn02_00205377 predicted 836
5 SASI_Rn02_00205378 predicted 839
6 SASI_Rn02_00205379 predicted 1026
7 SASI_Rn02_00205380 predicted 767
8 SASI_Rn02_00205381 predicted 1147
9 SASI_Rn02_00205382 predicted 310
10 SASI_Rn02_00205383 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00133877 predicted 1000
2 SASI_Rn01_00133878 predicted 840
3 SASI_Rn01_00133879 predicted 835
4 SASI_Rn01_00133880 predicted 817
5 SASI_Rn01_00133881 predicted 869
6 SASI_Rn01_00133882 predicted 798
7 SASI_Rn01_00133883 predicted 827
8 SASI_Rn01_00133884 predicted 783
9 SASI_Rn01_00133885 predicted 832
10 SASI_Rn01_00133886 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100915 predicted 1427
2 SASI_Mm01_00100916 predicted 1502
3 SASI_Mm01_00100917 predicted 1474
4 SASI_Mm02_00321147 predicted 1434
5 SASI_Mm02_00321148 predicted 1489
6 SASI_Mm02_00321149 predicted 1445
7 SASI_Mm01_00100908 predicted 739
8 SASI_Mm01_00100909 predicted 734
9 SASI_Mm01_00100910 predicted 717
10 SASI_Mm01_00100911 predicted 762
11 SASI_Mm01_00100912 predicted 771
12 SASI_Mm01_00100913 predicted 1381
13 SASI_Mm01_00100914 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006082
VALIDATED
TUBA1B MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 1b
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-281s1c1
Sequence:CCGGCCCACAGTCATTGATGAAGTTCTCGAGAACTTCATCAATGACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006082.1-1352s1c1
Sequence:CCGGGAGAAGGATTATGAGGAGGTTCTCGAGAACCTCCTCATAATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-260s1c1
Sequence:CCGGGCTGTGTTTGTAGACTTGGAACTCGAGTTCCAAGTCTACAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006082.1-1370s1c1
Sequence:CCGGGTTGGTGTGGATTCTGTTGAACTCGAGTTCAACAGAATCCACACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-1243s1c1
Sequence:CCGGCCACAAGTTTGACCTGATGTACTCGAGTACATCAGGTCAAACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-899s1c1
Sequence:CCGGGCTGAGAAAGCCTACCATGAACTCGAGTTCATGGTAGGCTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-1343s1c1
Sequence:CCGGGCTGCCCTTGAGAAGGATTATCTCGAGATAATCCTTCTCAAGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006082.2-414s21c1
Sequence:CCGGGCTGTGTTTGTAGACTTGGAACTCGAGTTCCAAGTCTACAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006082.2-1053s21c1
Sequence:CCGGGCTGAGAAAGCCTACCATGAACTCGAGTTCATGGTAGGCTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006082.2-1397s21c1
Sequence:CCGGCCACAAGTTTGACCTGATGTACTCGAGTACATCAGGTCAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006082.2-1562s21c1
Sequence:CCGGAGGAGAGGAATACTAATTATCCTCGAGGATAATTAGTATTCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006082
VALIDATED
TUBA1B MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 1b
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-281s1c1
Sequence:CCGGCCCACAGTCATTGATGAAGTTCTCGAGAACTTCATCAATGACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006082.1-1352s1c1
Sequence:CCGGGAGAAGGATTATGAGGAGGTTCTCGAGAACCTCCTCATAATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-260s1c1
Sequence:CCGGGCTGTGTTTGTAGACTTGGAACTCGAGTTCCAAGTCTACAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006082.1-1370s1c1
Sequence:CCGGGTTGGTGTGGATTCTGTTGAACTCGAGTTCAACAGAATCCACACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-1243s1c1
Sequence:CCGGCCACAAGTTTGACCTGATGTACTCGAGTACATCAGGTCAAACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-899s1c1
Sequence:CCGGGCTGAGAAAGCCTACCATGAACTCGAGTTCATGGTAGGCTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-1343s1c1
Sequence:CCGGGCTGCCCTTGAGAAGGATTATCTCGAGATAATCCTTCTCAAGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006082.2-414s21c1
Sequence:CCGGGCTGTGTTTGTAGACTTGGAACTCGAGTTCCAAGTCTACAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006082.2-1053s21c1
Sequence:CCGGGCTGAGAAAGCCTACCATGAACTCGAGTTCATGGTAGGCTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006082.2-1397s21c1
Sequence:CCGGCCACAAGTTTGACCTGATGTACTCGAGTACATCAGGTCAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006082.2-1562s21c1
Sequence:CCGGAGGAGAGGAATACTAATTATCCTCGAGGATAATTAGTATTCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006082
VALIDATED
TUBA1B MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 1b
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-281s1c1
Sequence:CCGGCCCACAGTCATTGATGAAGTTCTCGAGAACTTCATCAATGACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006082.1-1352s1c1
Sequence:CCGGGAGAAGGATTATGAGGAGGTTCTCGAGAACCTCCTCATAATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-260s1c1
Sequence:CCGGGCTGTGTTTGTAGACTTGGAACTCGAGTTCCAAGTCTACAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006082.1-1370s1c1
Sequence:CCGGGTTGGTGTGGATTCTGTTGAACTCGAGTTCAACAGAATCCACACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-1243s1c1
Sequence:CCGGCCACAAGTTTGACCTGATGTACTCGAGTACATCAGGTCAAACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-899s1c1
Sequence:CCGGGCTGAGAAAGCCTACCATGAACTCGAGTTCATGGTAGGCTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006082.1-1343s1c1
Sequence:CCGGGCTGCCCTTGAGAAGGATTATCTCGAGATAATCCTTCTCAAGGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006082.2-414s21c1
Sequence:CCGGGCTGTGTTTGTAGACTTGGAACTCGAGTTCCAAGTCTACAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006082.2-1053s21c1
Sequence:CCGGGCTGAGAAAGCCTACCATGAACTCGAGTTCATGGTAGGCTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006082.2-1397s21c1
Sequence:CCGGCCACAAGTTTGACCTGATGTACTCGAGTACATCAGGTCAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006082.2-1562s21c1
Sequence:CCGGAGGAGAGGAATACTAATTATCCTCGAGGATAATTAGTATTCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011654
TUBA1B MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 1b
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-941s1c1
Sequence:CCGGGCAGCTTTCTGTAGCAGAGATCTCGAGATCTCTGCTACAGAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-194s1c1
Sequence:CCGGGATGCCAAGTGACAAGACCATCTCGAGATGGTCTTGTCACTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-557s1c1
Sequence:CCGGGCTCTCTGTGGATTACGGAAACTCGAGTTTCCGTAATCCACAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-374s1c1
Sequence:CCGGCAAGGAGGATGCTGCCAATAACTCGAGTTATTGGCAGCATCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-1266s1c1
Sequence:CCGGCACAAGTTTGATCTGATGTATCTCGAGATACATCAGATCAAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011654
TUBA1B MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 1b
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-941s1c1
Sequence:CCGGGCAGCTTTCTGTAGCAGAGATCTCGAGATCTCTGCTACAGAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-194s1c1
Sequence:CCGGGATGCCAAGTGACAAGACCATCTCGAGATGGTCTTGTCACTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-557s1c1
Sequence:CCGGGCTCTCTGTGGATTACGGAAACTCGAGTTTCCGTAATCCACAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-374s1c1
Sequence:CCGGCAAGGAGGATGCTGCCAATAACTCGAGTTATTGGCAGCATCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-1266s1c1
Sequence:CCGGCACAAGTTTGATCTGATGTATCTCGAGATACATCAGATCAAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011654
TUBA1B MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 1b
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-941s1c1
Sequence:CCGGGCAGCTTTCTGTAGCAGAGATCTCGAGATCTCTGCTACAGAAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-194s1c1
Sequence:CCGGGATGCCAAGTGACAAGACCATCTCGAGATGGTCTTGTCACTTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-557s1c1
Sequence:CCGGGCTCTCTGTGGATTACGGAAACTCGAGTTTCCGTAATCCACAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-374s1c1
Sequence:CCGGCAAGGAGGATGCTGCCAATAACTCGAGTTATTGGCAGCATCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011654.1-1266s1c1
Sequence:CCGGCACAAGTTTGATCTGATGTATCTCGAGATACATCAGATCAAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks