EMAIL THIS PAGE TO A FRIEND

TUBA1C

tubulin, alpha 1c

Synonyms: TUBA6 bcm948
UniProtKB ID: Q9BQE3
Gene ID:
Mouse(22146) tubulin, alpha 1C
Rat(300218) tubulin, alpha 1C
cow(504244) tubulin, alpha 1c
sheep(101119713) tubulin, alpha 1c
naked mole-rat(101728335) tubulin, alpha 1c
chicken(429035) tubulin, alpha 1c
Horse(100051901) tubulin, alpha 1c
domestic cat(101081992) tubulin, alpha 1c
dog(608138) tubulin, alpha 1c
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032704 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032704 Rosetta Predictions human pricing
NM_001011995 Rosetta Predictions rat pricing
XM_576340 Rosetta Predictions rat pricing
NM_009448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103608 predicted 1144
2 SASI_Hs02_00360238 predicted 755
3 SASI_Hs01_00103609 predicted 1496
4 SASI_Hs01_00103610 predicted 1506
5 SASI_Hs01_00103611 predicted 1434
6 SASI_Hs01_00103612 predicted 1506
7 SASI_Hs01_00103613 predicted 1465
8 SASI_Hs01_00103606 predicted 563
9 SASI_Hs01_00103607 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119915 predicted 767
2 SASI_Rn02_00200038 predicted 925
3 SASI_Rn02_00200039 predicted 822
4 SASI_Rn02_00200040 predicted 998
5 SASI_Rn02_00200041 predicted 297
6 SASI_Rn01_00119916 predicted 753
7 SASI_Rn02_00200042 predicted 1123
8 SASI_Rn02_00200043 predicted 920
9 SASI_Rn01_00119917 predicted 720
10 SASI_Rn01_00119918 predicted 746
11 SASI_Rn01_00119919 predicted 712
12 SASI_Rn01_00119920 predicted 297
13 SASI_Rn01_00119921 predicted 757
14 SASI_Rn01_00119922 predicted 1467
15 SASI_Rn01_00119923 predicted 1452
16 SASI_Rn01_00119924 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171183 predicted 1201
2 SASI_Rn01_00171184 predicted 1198
3 SASI_Rn01_00171185 predicted 1158
4 SASI_Rn01_00171186 predicted 1179
5 SASI_Rn01_00171187 predicted 1144
6 SASI_Rn01_00171188 predicted 734
7 SASI_Rn01_00171189 predicted 1189
8 SASI_Rn01_00171190 predicted 1911
9 SASI_Rn01_00171191 predicted 1886
10 SASI_Rn01_00171192 predicted 1928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087414 predicted 1383
2 SASI_Mm02_00316154 predicted 1540
3 SASI_Mm01_00087415 predicted 1900
4 SASI_Mm01_00087417 predicted 1919
5 SASI_Mm02_00316155 predicted 1933
6 SASI_Mm01_00087418 predicted 1922
7 SASI_Mm01_00087416 predicted 1947
8 SASI_Mm01_00087419 predicted 1836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032704
VALIDATED
TUBA1C MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 1c
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-384s21c1
Sequence:CCGGGCAAGGAAGATGCTGCCAATACTCGAGTATTGGCAGCATCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-314s21c1
Sequence:CCGGCCCACAGTCATTGATGAAGTTCTCGAGAACTTCATCAATGACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-763s21c1
Sequence:CCGGCCCAACCTACACTAACCTTAACTCGAGTTAAGGTTAGTGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-1376s21c1
Sequence:CCGGGCTGCCCTTGAGAAGGATTATCTCGAGATAATCCTTCTCAAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032704.2-763s1c1
Sequence:CCGGCCCAACCTACACTAACCTTAACTCGAGTTAAGGTTAGTGTAGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032704.2-1376s1c1
Sequence:CCGGGCTGCCCTTGAGAAGGATTATCTCGAGATAATCCTTCTCAAGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032704.2-384s1c1
Sequence:CCGGGCAAGGAAGATGCTGCCAATACTCGAGTATTGGCAGCATCTTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032704.2-688s1c1
Sequence:CCGGGCACTCTGATTGTGCCTTCATCTCGAGATGAAGGCACAATCAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032704.2-314s1c1
Sequence:CCGGCCCACAGTCATTGATGAAGTTCTCGAGAACTTCATCAATGACTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032704
VALIDATED
TUBA1C MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 1c
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-384s21c1
Sequence:CCGGGCAAGGAAGATGCTGCCAATACTCGAGTATTGGCAGCATCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-314s21c1
Sequence:CCGGCCCACAGTCATTGATGAAGTTCTCGAGAACTTCATCAATGACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-763s21c1
Sequence:CCGGCCCAACCTACACTAACCTTAACTCGAGTTAAGGTTAGTGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-1376s21c1
Sequence:CCGGGCTGCCCTTGAGAAGGATTATCTCGAGATAATCCTTCTCAAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032704.2-763s1c1
Sequence:CCGGCCCAACCTACACTAACCTTAACTCGAGTTAAGGTTAGTGTAGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032704.2-1376s1c1
Sequence:CCGGGCTGCCCTTGAGAAGGATTATCTCGAGATAATCCTTCTCAAGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032704.2-384s1c1
Sequence:CCGGGCAAGGAAGATGCTGCCAATACTCGAGTATTGGCAGCATCTTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032704.2-688s1c1
Sequence:CCGGGCACTCTGATTGTGCCTTCATCTCGAGATGAAGGCACAATCAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032704.2-314s1c1
Sequence:CCGGCCCACAGTCATTGATGAAGTTCTCGAGAACTTCATCAATGACTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032704
VALIDATED
TUBA1C MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 1c
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-384s21c1
Sequence:CCGGGCAAGGAAGATGCTGCCAATACTCGAGTATTGGCAGCATCTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-314s21c1
Sequence:CCGGCCCACAGTCATTGATGAAGTTCTCGAGAACTTCATCAATGACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-763s21c1
Sequence:CCGGCCCAACCTACACTAACCTTAACTCGAGTTAAGGTTAGTGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032704.3-1376s21c1
Sequence:CCGGGCTGCCCTTGAGAAGGATTATCTCGAGATAATCCTTCTCAAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032704.2-763s1c1
Sequence:CCGGCCCAACCTACACTAACCTTAACTCGAGTTAAGGTTAGTGTAGGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032704.2-1376s1c1
Sequence:CCGGGCTGCCCTTGAGAAGGATTATCTCGAGATAATCCTTCTCAAGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032704.2-384s1c1
Sequence:CCGGGCAAGGAAGATGCTGCCAATACTCGAGTATTGGCAGCATCTTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032704.2-688s1c1
Sequence:CCGGGCACTCTGATTGTGCCTTCATCTCGAGATGAAGGCACAATCAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_032704.2-314s1c1
Sequence:CCGGCCCACAGTCATTGATGAAGTTCTCGAGAACTTCATCAATGACTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009448
VALIDATED
TUBA1C MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 1c
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009448.4-1142s21c1
Sequence:CCGGTAGACAATGAGGCCATCTATGCTCGAGCATAGATGGCCTCATTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009448.4-1070s21c1
Sequence:CCGGCTGTGGTTGAGCCCTACAATTCTCGAGAATTGTAGGGCTCAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009448.4-1446s21c1
Sequence:CCGGTGACCCTCGCCATGGTAAATACTCGAGTATTTACCATGGCGAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009448.4-857s21c1
Sequence:CCGGCCATTGGCAAGGAGATCATTGCTCGAGCAATGATCTCCTTGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009448.4-1205s21c1
Sequence:CCGGCCAACCTTAACCGCCTTATTACTCGAGTAATAAGGCGGTTAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009448.2-1306s1c1
Sequence:CCGGGCTCGCCTAGATCACAAGTTTCTCGAGAAACTTGTGATCTAGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009448.2-1108s1c1
Sequence:CCGGGTGGTTCCCAAAGATGTCAATCTCGAGATTGACATCTTTGGGAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009448
VALIDATED
TUBA1C MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 1c
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009448.4-1142s21c1
Sequence:CCGGTAGACAATGAGGCCATCTATGCTCGAGCATAGATGGCCTCATTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009448.4-1070s21c1
Sequence:CCGGCTGTGGTTGAGCCCTACAATTCTCGAGAATTGTAGGGCTCAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009448.4-1446s21c1
Sequence:CCGGTGACCCTCGCCATGGTAAATACTCGAGTATTTACCATGGCGAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009448.4-857s21c1
Sequence:CCGGCCATTGGCAAGGAGATCATTGCTCGAGCAATGATCTCCTTGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009448.4-1205s21c1
Sequence:CCGGCCAACCTTAACCGCCTTATTACTCGAGTAATAAGGCGGTTAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009448.2-1306s1c1
Sequence:CCGGGCTCGCCTAGATCACAAGTTTCTCGAGAAACTTGTGATCTAGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009448.2-1108s1c1
Sequence:CCGGGTGGTTCCCAAAGATGTCAATCTCGAGATTGACATCTTTGGGAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009448
VALIDATED
TUBA1C MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 1c
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009448.4-1142s21c1
Sequence:CCGGTAGACAATGAGGCCATCTATGCTCGAGCATAGATGGCCTCATTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009448.4-1070s21c1
Sequence:CCGGCTGTGGTTGAGCCCTACAATTCTCGAGAATTGTAGGGCTCAACCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009448.4-1446s21c1
Sequence:CCGGTGACCCTCGCCATGGTAAATACTCGAGTATTTACCATGGCGAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009448.4-857s21c1
Sequence:CCGGCCATTGGCAAGGAGATCATTGCTCGAGCAATGATCTCCTTGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009448.4-1205s21c1
Sequence:CCGGCCAACCTTAACCGCCTTATTACTCGAGTAATAAGGCGGTTAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009448.2-1306s1c1
Sequence:CCGGGCTCGCCTAGATCACAAGTTTCTCGAGAAACTTGTGATCTAGGCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009448.2-1108s1c1
Sequence:CCGGGTGGTTCCCAAAGATGTCAATCTCGAGATTGACATCTTTGGGAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks