EMAIL THIS PAGE TO A FRIEND

TUBA3D

tubulin, alpha 3d

Synonyms: H2-ALPHA
Gene ID:
Human(113457) Summary: This gene encodes a member of the alpha tubulin family. Tubulin is a major component of microtubules, which are composed of alpha- and beta-tubulin heterodimers and microtubule-associated proteins in the cytoskeleton. Microtubules maintain cellular structure, function in intracellular transport, and play a role in spindle formation during mitosis. [provided by RefSeq, Oct 2011]
Horse(100072403) tubulin, alpha 3d
Horse(100052388) tubulin, alpha 3d
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080386 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080386 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192404 predicted 962
2 SASI_Hs01_00192406 predicted 199
3 SASI_Hs01_00192407 predicted 1340
4 SASI_Hs01_00192405 predicted 980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080386
TUBA3D MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 3d
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000116573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-1355s1c1
Sequence:CCGGGCAGCTCTAGAGAAGGATTATCTCGAGATAATCCTTCTCTAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-1123s1c1
Sequence:CCGGGACTGGATTTAAGGTGGGCATCTCGAGATGCCCACCTTAAATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-680s1c1
Sequence:CCGGGCCTTCATGGTCGACAATGAACTCGAGTTCATTGTCGACCATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-573s1c1
Sequence:CCGGCCAAGCTAGAGTTTGCCATTTCTCGAGAAATGGCAAACTCTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080386
TUBA3D MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 3d
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000116573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-1355s1c1
Sequence:CCGGGCAGCTCTAGAGAAGGATTATCTCGAGATAATCCTTCTCTAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-1123s1c1
Sequence:CCGGGACTGGATTTAAGGTGGGCATCTCGAGATGCCCACCTTAAATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-680s1c1
Sequence:CCGGGCCTTCATGGTCGACAATGAACTCGAGTTCATTGTCGACCATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-573s1c1
Sequence:CCGGCCAAGCTAGAGTTTGCCATTTCTCGAGAAATGGCAAACTCTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080386
TUBA3D MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 3d
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000116573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-1355s1c1
Sequence:CCGGGCAGCTCTAGAGAAGGATTATCTCGAGATAATCCTTCTCTAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-1123s1c1
Sequence:CCGGGACTGGATTTAAGGTGGGCATCTCGAGATGCCCACCTTAAATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-680s1c1
Sequence:CCGGGCCTTCATGGTCGACAATGAACTCGAGTTCATTGTCGACCATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080386.1-573s1c1
Sequence:CCGGCCAAGCTAGAGTTTGCCATTTCTCGAGAAATGGCAAACTCTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks