EMAIL THIS PAGE TO A FRIEND

TUBA3E

tubulin, alpha 3e

UniProtKB ID: Q6PEY2
Gene ID:
chicken(421169) tubulin, alpha 3e
cow(100295712) tubulin, alpha 3e
cow(534900) tubulin, alpha 3e
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_053177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_053177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_053177 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207312 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373844 predicted 948
2 SASI_Hs01_00114292 predicted 1107
3 SASI_Hs01_00114293 predicted 388
4 SASI_Hs01_00114294 predicted 749
5 SASI_Hs01_00114296 predicted 1108
6 SASI_Hs01_00114297 predicted 1377
7 SASI_Hs01_00114298 predicted 388
8 SASI_Hs01_00114295 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_053177
TUBA3E MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 3e
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000117167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1116s1c1
Sequence:CCGGCGCACTATCCAGTTTGTGGATCTCGAGATCCACAAACTGGATAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1278s1c1
Sequence:CCGGCATAAGTTCGATCTCATGTATCTCGAGATACATGAGATCGAACTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1380s1c1
Sequence:CCGGGCTCTAGAGAAGGATTGTGAACTCGAGTTCACAATCCTTCTCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1147s1c1
Sequence:CCGGCTGGATTTAAGGTGGGCATTACTCGAGTAATGCCCACCTTAAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_053177
TUBA3E MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 3e
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000117167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1116s1c1
Sequence:CCGGCGCACTATCCAGTTTGTGGATCTCGAGATCCACAAACTGGATAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1278s1c1
Sequence:CCGGCATAAGTTCGATCTCATGTATCTCGAGATACATGAGATCGAACTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1380s1c1
Sequence:CCGGGCTCTAGAGAAGGATTGTGAACTCGAGTTCACAATCCTTCTCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1147s1c1
Sequence:CCGGCTGGATTTAAGGTGGGCATTACTCGAGTAATGCCCACCTTAAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_053177
TUBA3E MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 3e
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000117167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1116s1c1
Sequence:CCGGCGCACTATCCAGTTTGTGGATCTCGAGATCCACAAACTGGATAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1278s1c1
Sequence:CCGGCATAAGTTCGATCTCATGTATCTCGAGATACATGAGATCGAACTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1380s1c1
Sequence:CCGGGCTCTAGAGAAGGATTGTGAACTCGAGTTCACAATCCTTCTCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_053177.7-1147s1c1
Sequence:CCGGCTGGATTTAAGGTGGGCATTACTCGAGTAATGCCCACCTTAAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks