EMAIL THIS PAGE TO A FRIEND

TUBA3FP

tubulin, alpha 3f, pseudogene

Species: Human TUBA3FP(113691)
Gene ID:
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408215 Anti-MGC16703 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145042 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145042 Rosetta Predictions human pricing
NR_003608 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190367 predicted 1220
2 SASI_Hs01_00190368 predicted 797
3 SASI_Hs01_00190369 predicted 1195
4 SASI_Hs01_00190370 predicted 927
5 SASI_Hs01_00190371 predicted 796
6 SASI_Hs01_00190372 predicted 820
7 SASI_Hs01_00190373 predicted 1393
8 SASI_Hs01_00190374 predicted 1361
9 SASI_Hs01_00190375 predicted 1359
10 SASI_Hs01_00190376 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379865 predicted 1357
2 SASI_Hs02_00379866 predicted 401
3 SASI_Hs02_00379867 predicted 932
4 SASI_Hs02_00379868 predicted 1336
5 SASI_Hs02_00379869 predicted 1068
6 SASI_Hs02_00379870 predicted 389
7 SASI_Hs02_00379871 predicted 369
8 SASI_Hs02_00379872 predicted 965
9 SASI_Hs02_00379873 predicted 1609
10 SASI_Hs02_00379874 predicted 1500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145042
TUBA3FP MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 3f, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145042.2-1396s1c1
Sequence:CCGGCGCCTTATACTTTACCAAATACTCGAGTATTTGGTAAAGTATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-793s1c1
Sequence:CCGGGCCTTCATAGTCAACAGCAAACTCGAGTTTGCTGTTGACTATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-555s1c1
Sequence:CCGGGCTGAATGACCAAGCAGATCTCTCGAGAGATCTGCTTGGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-802s1c1
Sequence:CCGGGTCAACAGCAAAGCCACCTATCTCGAGATAGGTGGCTTTGCTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-594s1c1
Sequence:CCGGCTTCCTCATCTTCCACAGCTTCTCGAGAAGCTGTGGAAGATGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145042
TUBA3FP MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 3f, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145042.2-1396s1c1
Sequence:CCGGCGCCTTATACTTTACCAAATACTCGAGTATTTGGTAAAGTATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-793s1c1
Sequence:CCGGGCCTTCATAGTCAACAGCAAACTCGAGTTTGCTGTTGACTATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-555s1c1
Sequence:CCGGGCTGAATGACCAAGCAGATCTCTCGAGAGATCTGCTTGGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-802s1c1
Sequence:CCGGGTCAACAGCAAAGCCACCTATCTCGAGATAGGTGGCTTTGCTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-594s1c1
Sequence:CCGGCTTCCTCATCTTCCACAGCTTCTCGAGAAGCTGTGGAAGATGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145042
TUBA3FP MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 3f, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113806    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145042.2-1396s1c1
Sequence:CCGGCGCCTTATACTTTACCAAATACTCGAGTATTTGGTAAAGTATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-793s1c1
Sequence:CCGGGCCTTCATAGTCAACAGCAAACTCGAGTTTGCTGTTGACTATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-555s1c1
Sequence:CCGGGCTGAATGACCAAGCAGATCTCTCGAGAGATCTGCTTGGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-802s1c1
Sequence:CCGGGTCAACAGCAAAGCCACCTATCTCGAGATAGGTGGCTTTGCTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145042.2-594s1c1
Sequence:CCGGCTTCCTCATCTTCCACAGCTTCTCGAGAAGCTGTGGAAGATGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks