EMAIL THIS PAGE TO A FRIEND

TUBA4A

tubulin, alpha 4a

Synonyms: H2-ALPHA TUBA1
UniProtKB ID: P68366, B3KNQ6, P05215
Gene ID:
Human(7277) Summary: Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene encodes an alpha tubulin that is a highly conserved homolog of a rat testis-specific alpha tubulin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Mouse(22145) tubulin, alpha 4A
Rat(316531) tubulin, alpha 4A
chicken(418166) tubulin, alpha 4a
domestic cat(101095277) tubulin, alpha 4a
Horse(100059249) tubulin, alpha 4a
dog(478918) tubulin, alpha 4a
cow(777775) tubulin, alpha 4a
sheep(443104) tubulin, alpha 4a
sheep(100302357) tubulin, alpha 4a
domestic guinea pig(100734500) tubulin, alpha 4a
naked mole-rat(101720265) tubulin, alpha 4a
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
T6199 Anti-α-Tubulin antibody, Mouse monoclonal clone DM1A, purified from hybridoma cell culture yeast, human, chicken, rat, amphibian, fungi, bovine, mouse
immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing
F2168 Anti-α-Tubulin−FITC antibody, Mouse monoclonal clone DM1A, purified from hybridoma cell culture yeast, human, chicken, rat, amphibian, fungi, bovine, mouse
immunofluorescence pricing
SAB4504761 Anti-phospho-TUBA1/3/4 (pTyr272) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB1411818 ANTI-TUBA1 antibody produced in mouse clone 1G12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411819 ANTI-TUBA1 antibody produced in mouse clone 2A11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411824 ANTI-TUBA1 antibody produced in mouse clone 2E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2102603 Anti-TUBA4A antibody produced in rabbit affinity isolated antibody mouse, rat, guinea pig, canine, horse, bovine, human, rabbit, sheep
western blot pricing
SAB2104447 Anti-TUBA4A antibody produced in rabbit affinity isolated antibody Arabidopsis sp., mouse, rat, rabbit, Caenorhabditis elegans, human, sheep,
western blot pricing
T6074 Monoclonal Anti-α-Tubulin antibody produced in mouse clone B-5-1-2, purified immunoglobulin, buffered aqueous solution human, Chlamydomonas, African green monkey, chicken, mouse, bovine, rat, kangaroo rat, sea urchin
immunocytochemistry, immunoprecipitation, microarray, western blot pricing
T5168 Monoclonal Anti-α-Tubulin antibody produced in mouse ascites fluid, clone B-5-1-2 human, Chlamydomonas, African green monkey, chicken, mouse, bovine, rat, kangaroo rat, sea urchin
immunofluorescence, radioimmunoassay, western blot pricing
T9026 Monoclonal Anti-α-Tubulin antibody produced in mouse clone DM1A, ascites fluid yeast, human, chicken, rat, amphibian, fungi, bovine, mouse
immunofluorescence, western blot pricing
T7451 Monoclonal Anti-Acetylated Tubulin antibody produced in mouse clone 6-11B-1, purified from hybridoma cell culture monkey, protista, mouse, pig, human, bovine, invertebrates, rat, hamster, plant, frog, chicken
dot blot, electron microscopy, immunohistochemistry, radioimmunoassay, western blot pricing
WH0007277M1 Monoclonal Anti-TUBA1 antibody produced in mouse clone 2E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404496 Monoclonal Anti-TUBA1 antibody produced in mouse clone 1E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
T6793 Monoclonal Anti-Tubulin, Acetylated antibody produced in mouse clone 6-11B-1, ascites fluid plant, human, pig, monkey, invertebrates, hamster, bovine, chicken, rat, frog, protista, mouse
dot blot, electron microscopy, ELISA, immunocytochemistry, radioimmunoassay, western blot pricing
T9822 Monoclonal Anti-Tubulin, Polyglutamylated antibody produced in mouse clone B3, purified from hybridoma cell culture mouse, Oxyrrhis marina (dinoflagellate), sea urchin (Lytechinus pictus and three others.), chicken, human, bovine, rabbit, rat, monkey
ELISA, immunocytochemistry, microarray, western blot pricing
T9028 Monoclonal Anti-Tubulin, Tyrosine antibody produced in mouse clone TUB-1A2, ascites fluid plant, animal, human
immunofluorescence, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006000 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006000 Rosetta Predictions human pricing
NM_001007004 Rosetta Predictions rat pricing
NM_009447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236611 predicted 496
2 SASI_Hs01_00236613 predicted 357
3 SASI_Hs01_00236614 predicted 1098
4 SASI_Hs01_00236612 predicted 205
5 SASI_Hs01_00236615 predicted 370
6 SASI_Hs01_00236616 predicted 213
7 SASI_Hs01_00236618 predicted 290
8 SASI_Hs01_00236619 predicted 1415
9 SASI_Hs01_00236617 predicted 139
10 SASI_Hs01_00236620 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108626 predicted 1072
2 SASI_Rn01_00108627 predicted 403
3 SASI_Rn01_00108629 predicted 236
4 SASI_Rn01_00108631 predicted 399
5 SASI_Rn01_00108632 predicted 242
6 SASI_Rn01_00108633 predicted 290
7 SASI_Rn01_00108634 predicted 1071
8 SASI_Rn01_00108635 predicted 1161
9 SASI_Rn02_00198592 predicted 490
10 SASI_Rn02_00198593 predicted 1029
11 SASI_Rn01_00108628 predicted 855
12 SASI_Rn01_00108630 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125097 predicted 666
2 SASI_Mm02_00316152 predicted 659
3 SASI_Mm01_00125098 predicted 447
4 SASI_Mm01_00125099 predicted 328
5 SASI_Mm01_00125100 predicted 1011
6 SASI_Mm01_00125101 predicted 702
7 SASI_Mm01_00125103 predicted 864
8 SASI_Mm02_00316153 predicted 745
9 SASI_Mm01_00125104 predicted 358
10 SASI_Mm01_00125105 predicted 455
11 SASI_Mm01_00125102 predicted 761
12 SASI_Mm01_00125106 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006000
TUBA4A MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 4a
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-271s1c1
Sequence:CCGGGCCTACGGTCATTGATGAGATCTCGAGATCTCATCAATGACCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-668s1c1
Sequence:CCGGGTGGACAACGAAGCAATCTATCTCGAGATAGATTGCTTCGTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-216s1c1
Sequence:CCGGTCTGTGAAACTGGTGCTGGAACTCGAGTTCCAGCACCAGTTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-526s1c1
Sequence:CCGGGCTCTCTGTTGACTATGGCAACTCGAGTTGCCATAGTCAACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-368s1c1
Sequence:CCGGGCCCGTGGTCACTATACCATTCTCGAGAATGGTATAGTGACCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-327s21c1
Sequence:CCGGAGCAGCTCATCACTGGGAAAGCTCGAGCTTTCCCAGTGATGAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-399s21c1
Sequence:CCGGTCATTGACCCAGTGCTGGATCCTCGAGGATCCAGCACTGGGTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-602s21c1
Sequence:CCGGGTCGAGCCCTACAACTCTATCCTCGAGGATAGAGTTGTAGGGCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-1004s21c1
Sequence:CCGGTGCCTGCTGTACCGTGGAGATCTCGAGATCTCCACGGTACAGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006000
TUBA4A MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 4a
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-271s1c1
Sequence:CCGGGCCTACGGTCATTGATGAGATCTCGAGATCTCATCAATGACCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-668s1c1
Sequence:CCGGGTGGACAACGAAGCAATCTATCTCGAGATAGATTGCTTCGTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-216s1c1
Sequence:CCGGTCTGTGAAACTGGTGCTGGAACTCGAGTTCCAGCACCAGTTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-526s1c1
Sequence:CCGGGCTCTCTGTTGACTATGGCAACTCGAGTTGCCATAGTCAACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-368s1c1
Sequence:CCGGGCCCGTGGTCACTATACCATTCTCGAGAATGGTATAGTGACCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-327s21c1
Sequence:CCGGAGCAGCTCATCACTGGGAAAGCTCGAGCTTTCCCAGTGATGAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-399s21c1
Sequence:CCGGTCATTGACCCAGTGCTGGATCCTCGAGGATCCAGCACTGGGTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-602s21c1
Sequence:CCGGGTCGAGCCCTACAACTCTATCCTCGAGGATAGAGTTGTAGGGCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-1004s21c1
Sequence:CCGGTGCCTGCTGTACCGTGGAGATCTCGAGATCTCCACGGTACAGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006000
TUBA4A MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 4a
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-271s1c1
Sequence:CCGGGCCTACGGTCATTGATGAGATCTCGAGATCTCATCAATGACCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-668s1c1
Sequence:CCGGGTGGACAACGAAGCAATCTATCTCGAGATAGATTGCTTCGTTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-216s1c1
Sequence:CCGGTCTGTGAAACTGGTGCTGGAACTCGAGTTCCAGCACCAGTTTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-526s1c1
Sequence:CCGGGCTCTCTGTTGACTATGGCAACTCGAGTTGCCATAGTCAACAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006000.1-368s1c1
Sequence:CCGGGCCCGTGGTCACTATACCATTCTCGAGAATGGTATAGTGACCACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-327s21c1
Sequence:CCGGAGCAGCTCATCACTGGGAAAGCTCGAGCTTTCCCAGTGATGAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-399s21c1
Sequence:CCGGTCATTGACCCAGTGCTGGATCCTCGAGGATCCAGCACTGGGTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-602s21c1
Sequence:CCGGGTCGAGCCCTACAACTCTATCCTCGAGGATAGAGTTGTAGGGCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006000.1-1004s21c1
Sequence:CCGGTGCCTGCTGTACCGTGGAGATCTCGAGATCTCCACGGTACAGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009447
VALIDATED
TUBA4A MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 4a
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009447.2-272s1c1
Sequence:CCGGGCCTACTGTAATCGATGAGATCTCGAGATCTCATCGATTACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009447.2-706s1c1
Sequence:CCGGACCTAGATATTGAGCGTCCAACTCGAGTTGGACGCTCAATATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009447.2-1235s1c1
Sequence:CCGGCCACAAGTTTGACTTGATGTACTCGAGTACATCAAGTCAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009447.2-867s1c1
Sequence:CCGGGCTACCTATGCACCAGTCATTCTCGAGAATGACTGGTGCATAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009447.2-1846s1c1
Sequence:CCGGGCGTCATTGAACACTGAGGATCTCGAGATCCTCAGTGTTCAATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-1234s21c1
Sequence:CCGGCCACAAGTTTGACTTGATGTACTCGAGTACATCAAGTCAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-866s21c1
Sequence:CCGGGCTACCTATGCACCAGTCATTCTCGAGAATGACTGGTGCATAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-705s21c1
Sequence:CCGGACCTAGATATTGAGCGTCCAACTCGAGTTGGACGCTCAATATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-271s21c1
Sequence:CCGGGCCTACTGTAATCGATGAGATCTCGAGATCTCATCGATTACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009447
VALIDATED
TUBA4A MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 4a
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009447.2-272s1c1
Sequence:CCGGGCCTACTGTAATCGATGAGATCTCGAGATCTCATCGATTACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009447.2-706s1c1
Sequence:CCGGACCTAGATATTGAGCGTCCAACTCGAGTTGGACGCTCAATATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009447.2-1235s1c1
Sequence:CCGGCCACAAGTTTGACTTGATGTACTCGAGTACATCAAGTCAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009447.2-867s1c1
Sequence:CCGGGCTACCTATGCACCAGTCATTCTCGAGAATGACTGGTGCATAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009447.2-1846s1c1
Sequence:CCGGGCGTCATTGAACACTGAGGATCTCGAGATCCTCAGTGTTCAATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-1234s21c1
Sequence:CCGGCCACAAGTTTGACTTGATGTACTCGAGTACATCAAGTCAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-866s21c1
Sequence:CCGGGCTACCTATGCACCAGTCATTCTCGAGAATGACTGGTGCATAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-705s21c1
Sequence:CCGGACCTAGATATTGAGCGTCCAACTCGAGTTGGACGCTCAATATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-271s21c1
Sequence:CCGGGCCTACTGTAATCGATGAGATCTCGAGATCTCATCGATTACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009447
VALIDATED
TUBA4A MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 4a
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009447.2-272s1c1
Sequence:CCGGGCCTACTGTAATCGATGAGATCTCGAGATCTCATCGATTACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009447.2-706s1c1
Sequence:CCGGACCTAGATATTGAGCGTCCAACTCGAGTTGGACGCTCAATATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009447.2-1235s1c1
Sequence:CCGGCCACAAGTTTGACTTGATGTACTCGAGTACATCAAGTCAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009447.2-867s1c1
Sequence:CCGGGCTACCTATGCACCAGTCATTCTCGAGAATGACTGGTGCATAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009447.2-1846s1c1
Sequence:CCGGGCGTCATTGAACACTGAGGATCTCGAGATCCTCAGTGTTCAATGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-1234s21c1
Sequence:CCGGCCACAAGTTTGACTTGATGTACTCGAGTACATCAAGTCAAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-866s21c1
Sequence:CCGGGCTACCTATGCACCAGTCATTCTCGAGAATGACTGGTGCATAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-705s21c1
Sequence:CCGGACCTAGATATTGAGCGTCCAACTCGAGTTGGACGCTCAATATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009447.3-271s21c1
Sequence:CCGGGCCTACTGTAATCGATGAGATCTCGAGATCTCATCGATTACAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks