EMAIL THIS PAGE TO A FRIEND

TUBA4B

tubulin, alpha 4b (pseudogene)

Synonyms: TUBA4
Species: Human TUBA4B(80086)
UniProtKB ID: Q9H853
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025019 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003063 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00377979 predicted 421
2 SASI_Hs02_00377980 predicted 1021
3 SASI_Hs02_00377981 predicted 923
4 SASI_Hs02_00377982 predicted 752
5 SASI_Hs02_00377983 predicted 1073
6 SASI_Hs02_00377984 predicted 413
7 SASI_Hs02_00377985 predicted 340
8 SASI_Hs02_00377986 predicted 72
9 SASI_Hs02_00377987 predicted 316
10 SASI_Hs02_00377988 predicted 39
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025019
TUBA4B MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 4b (pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025019.1-1024s1c1
Sequence:CCGGCCACAGGCTTTAAGGTTGATACTCGAGTATCAACCTTAAAGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-219s1c1
Sequence:CCGGGCATGGCACATACCGCCAGATCTCGAGATCTGGCGGTATGTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-434s1c1
Sequence:CCGGCATTCCTGATGGAGTGGCTTTCTCGAGAAAGCCACTCCATCAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-656s1c1
Sequence:CCGGCCAACCTCAATCGCCTCATTACTCGAGTAATGAGGCGATTGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-583s1c1
Sequence:CCGGGCCTTCATGGTGGACAACAAACTCGAGTTTGTTGTCCACCATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025019
TUBA4B MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 4b (pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025019.1-1024s1c1
Sequence:CCGGCCACAGGCTTTAAGGTTGATACTCGAGTATCAACCTTAAAGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-219s1c1
Sequence:CCGGGCATGGCACATACCGCCAGATCTCGAGATCTGGCGGTATGTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-434s1c1
Sequence:CCGGCATTCCTGATGGAGTGGCTTTCTCGAGAAAGCCACTCCATCAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-656s1c1
Sequence:CCGGCCAACCTCAATCGCCTCATTACTCGAGTAATGAGGCGATTGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-583s1c1
Sequence:CCGGGCCTTCATGGTGGACAACAAACTCGAGTTTGTTGTCCACCATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025019
TUBA4B MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 4b (pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025019.1-1024s1c1
Sequence:CCGGCCACAGGCTTTAAGGTTGATACTCGAGTATCAACCTTAAAGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-219s1c1
Sequence:CCGGGCATGGCACATACCGCCAGATCTCGAGATCTGGCGGTATGTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-434s1c1
Sequence:CCGGCATTCCTGATGGAGTGGCTTTCTCGAGAAAGCCACTCCATCAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-656s1c1
Sequence:CCGGCCAACCTCAATCGCCTCATTACTCGAGTAATGAGGCGATTGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025019.1-583s1c1
Sequence:CCGGGCCTTCATGGTGGACAACAAACTCGAGTTTGTTGTCCACCATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks