EMAIL THIS PAGE TO A FRIEND

TUBA8

tubulin, alpha 8

Synonyms: TUBAL2
UniProtKB ID: Q9NY65, B2RCX2, B3KPW9, B4DWG3, Q2M3N4
Gene ID:
Human(51807) Summary: This gene encodes a member of the alpha tubulin protein family. Alpha tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. Mutations in this gene are associated with polymicrogyria and optic nerve hypoplasia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
Mouse(53857) tubulin, alpha 8
Rat(500377) tubulin, alpha 8
chicken(396426) tubulin, alpha 8
dog(486762) tubulin, alpha 8
Horse(100054576) tubulin, alpha 8
naked mole-rat(101709208) tubulin, alpha 8
cow(768036) tubulin, alpha 8
sheep(101118605) tubulin, alpha 8
Gene Class: Cytoskeleton
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018943 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU054001 MISSION® esiRNA esiRNA targeting mouse Tuba8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018943 Rosetta Predictions human pricing
NM_001024339 Rosetta Predictions rat pricing
NM_017379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203604 predicted 765
2 SASI_Hs01_00203605 predicted 412
3 SASI_Hs01_00203606 predicted 653
4 SASI_Hs01_00203607 predicted 1512
5 SASI_Hs01_00203608 predicted 904
6 SASI_Hs01_00203609 predicted 1371
7 SASI_Hs01_00203610 predicted 893
8 SASI_Hs01_00203611 predicted 729
9 SASI_Hs01_00203612 predicted 1472
10 SASI_Hs01_00203613 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036603 predicted 973
2 SASI_Rn01_00036605 predicted 414
3 SASI_Rn01_00036606 predicted 897
4 SASI_Rn01_00036607 predicted 395
5 SASI_Rn01_00036608 predicted 799
6 SASI_Rn01_00036609 predicted 1090
7 SASI_Rn01_00036610 predicted 476
8 SASI_Rn01_00036611 predicted 358
9 SASI_Rn01_00036612 predicted 615
10 SASI_Rn02_00202567 predicted 996
11 SASI_Rn01_00036604 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093293 predicted 808
2 SASI_Mm01_00093294 predicted 1075
3 SASI_Mm01_00093295 predicted 406
4 SASI_Mm01_00093296 predicted 420
5 SASI_Mm01_00093297 predicted 338
6 SASI_Mm01_00093298 predicted 503
7 SASI_Mm01_00093299 predicted 397
8 SASI_Mm01_00093300 predicted 1073
9 SASI_Mm01_00093301 predicted 983
10 SASI_Mm01_00093302 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018943
TUBA8 MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018943.1-1833s1c1
Sequence:CCGGCGTTCACATGAGTGGGTCTATCTCGAGATAGACCCACTCATGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-287s1c1
Sequence:CCGGCCTACTGTAGTGGATGAGGTTCTCGAGAACCTCATCCACTACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-651s1c1
Sequence:CCGGCCACACTGGAACATTCAGATTCTCGAGAATCTGAATGTTCCAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-1048s1c1
Sequence:CCGGCAAGGATGTGAATGTCGCTATCTCGAGATAGCGACATTCACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-191s1c1
Sequence:CCGGGCTAGCAAGATCAACGATGATCTCGAGATCATCGTTGATCTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018943.1-536s21c1
Sequence:CCGGGAACGCCTCTCCCTGGATTATCTCGAGATAATCCAGGGAGAGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018943.1-1700s21c1
Sequence:CCGGGCCTAATCAGGAGTTTCAATTCTCGAGAATTGAAACTCCTGATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018943.1-756s21c1
Sequence:CCGGACCGCCTCATCAGTCAGATTGCTCGAGCAATCTGACTGATGAGGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018943
TUBA8 MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018943.1-1833s1c1
Sequence:CCGGCGTTCACATGAGTGGGTCTATCTCGAGATAGACCCACTCATGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-287s1c1
Sequence:CCGGCCTACTGTAGTGGATGAGGTTCTCGAGAACCTCATCCACTACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-651s1c1
Sequence:CCGGCCACACTGGAACATTCAGATTCTCGAGAATCTGAATGTTCCAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-1048s1c1
Sequence:CCGGCAAGGATGTGAATGTCGCTATCTCGAGATAGCGACATTCACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-191s1c1
Sequence:CCGGGCTAGCAAGATCAACGATGATCTCGAGATCATCGTTGATCTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018943.1-536s21c1
Sequence:CCGGGAACGCCTCTCCCTGGATTATCTCGAGATAATCCAGGGAGAGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018943.1-1700s21c1
Sequence:CCGGGCCTAATCAGGAGTTTCAATTCTCGAGAATTGAAACTCCTGATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018943.1-756s21c1
Sequence:CCGGACCGCCTCATCAGTCAGATTGCTCGAGCAATCTGACTGATGAGGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018943
TUBA8 MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018943.1-1833s1c1
Sequence:CCGGCGTTCACATGAGTGGGTCTATCTCGAGATAGACCCACTCATGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-287s1c1
Sequence:CCGGCCTACTGTAGTGGATGAGGTTCTCGAGAACCTCATCCACTACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-651s1c1
Sequence:CCGGCCACACTGGAACATTCAGATTCTCGAGAATCTGAATGTTCCAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-1048s1c1
Sequence:CCGGCAAGGATGTGAATGTCGCTATCTCGAGATAGCGACATTCACATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018943.1-191s1c1
Sequence:CCGGGCTAGCAAGATCAACGATGATCTCGAGATCATCGTTGATCTTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018943.1-536s21c1
Sequence:CCGGGAACGCCTCTCCCTGGATTATCTCGAGATAATCCAGGGAGAGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018943.1-1700s21c1
Sequence:CCGGGCCTAATCAGGAGTTTCAATTCTCGAGAATTGAAACTCCTGATTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018943.1-756s21c1
Sequence:CCGGACCGCCTCATCAGTCAGATTGCTCGAGCAATCTGACTGATGAGGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017379
VALIDATED
TUBA8 MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-930s1c1
Sequence:CCGGCAGAGATAACTAGCTCCTGTTCTCGAGAACAGGAGCTAGTTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017379.1-98s1c1
Sequence:CCGGGCCGGAGTTCAGATTGGCAATCTCGAGATTGCCAATCTGAACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-1237s1c1
Sequence:CCGGTGACCATAAGTTTGACCTCATCTCGAGATGAGGTCAAACTTATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-1072s1c1
Sequence:CCGGGACCAAGAGAACTATTCAGTTCTCGAGAACTGAATAGTTCTCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-192s1c1
Sequence:CCGGTCAACGATGACGACTCCTTTACTCGAGTAAAGGAGTCGTCATCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017379
VALIDATED
TUBA8 MISSION shRNA shRNA Plasmid DNA
tubulin, alpha 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-930s1c1
Sequence:CCGGCAGAGATAACTAGCTCCTGTTCTCGAGAACAGGAGCTAGTTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017379.1-98s1c1
Sequence:CCGGGCCGGAGTTCAGATTGGCAATCTCGAGATTGCCAATCTGAACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-1237s1c1
Sequence:CCGGTGACCATAAGTTTGACCTCATCTCGAGATGAGGTCAAACTTATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-1072s1c1
Sequence:CCGGGACCAAGAGAACTATTCAGTTCTCGAGAACTGAATAGTTCTCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-192s1c1
Sequence:CCGGTCAACGATGACGACTCCTTTACTCGAGTAAAGGAGTCGTCATCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017379
VALIDATED
TUBA8 MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-930s1c1
Sequence:CCGGCAGAGATAACTAGCTCCTGTTCTCGAGAACAGGAGCTAGTTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017379.1-98s1c1
Sequence:CCGGGCCGGAGTTCAGATTGGCAATCTCGAGATTGCCAATCTGAACTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-1237s1c1
Sequence:CCGGTGACCATAAGTTTGACCTCATCTCGAGATGAGGTCAAACTTATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-1072s1c1
Sequence:CCGGGACCAAGAGAACTATTCAGTTCTCGAGAACTGAATAGTTCTCTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017379.1-192s1c1
Sequence:CCGGTCAACGATGACGACTCCTTTACTCGAGTAAAGGAGTCGTCATCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks