EMAIL THIS PAGE TO A FRIEND

TUBAL3

tubulin, alpha-like 3

UniProtKB ID: A6NHL2, B4DKL2, Q4QQJ5, Q9H6Z0
Gene ID:
Mouse(238463) tubulin, alpha-like 3
Rat(291287) tubulin, alpha-like 3
chicken(416694) tubulin, alpha-like 3
dog(487148) tubulin, alpha-like 3
Horse(100146855) tubulin, alpha-like 3
domestic cat(101080975) tubulin, alpha-like 3
cow(538631) tubulin, alpha-like 3
sheep(101107301) tubulin, alpha-like 3
naked mole-rat(101697931) tubulin, alpha-like 3
Domestic Rabbit(100353478) tubulin, alpha-like 3
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024803 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_138401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_138401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_138401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007641 MISSION® esiRNA esiRNA targeting human TUBAL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024803 Rosetta Predictions human pricing
NM_001106118 Rosetta Predictions rat pricing
NM_001033879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041813 predicted 207
2 SASI_Hs01_00041814 predicted 811
3 SASI_Hs01_00041815 predicted 203
4 SASI_Hs01_00041816 predicted 235
5 SASI_Hs01_00041817 predicted 1377
6 SASI_Hs01_00041818 predicted 807
7 SASI_Hs01_00041819 predicted 804
8 SASI_Hs01_00041820 predicted 725
9 SASI_Hs01_00041821 predicted 1258
10 SASI_Hs02_00357346 predicted 782
11 SASI_Hs01_00041812 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215798 predicted 715
2 SASI_Rn02_00215799 predicted 739
3 SASI_Rn02_00215800 predicted 409
4 SASI_Rn02_00215801 predicted 634
5 SASI_Rn02_00215802 predicted 630
6 SASI_Rn02_00215803 predicted 897
7 SASI_Rn02_00215804 predicted 707
8 SASI_Rn02_00215805 predicted 585
9 SASI_Rn02_00215806 predicted 235
10 SASI_Rn02_00215807 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068013 predicted 500
2 SASI_Mm01_00068014 predicted 1461
3 SASI_Mm01_00068015 predicted 794
4 SASI_Mm01_00068017 predicted 646
5 SASI_Mm01_00068018 predicted 793
6 SASI_Mm02_00289033 predicted 1047
7 SASI_Mm01_00068020 predicted 797
8 SASI_Mm01_00068021 predicted 502
9 SASI_Mm01_00068022 predicted 832
10 SASI_Mm02_00289034 predicted 511
11 SASI_Mm01_00068016 predicted 809
12 SASI_Mm01_00068019 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024803
TUBAL3 MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha-like 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024803.2-596s21c1
Sequence:CCGGTGCTGTGGTAGAGCCTTATAACTCGAGTTATAAGGCTCTACCACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024803.2-725s21c1
Sequence:CCGGCTCTCATGCCAGCATCAATAGCTCGAGCTATTGATGCTGGCATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024803.2-1535s21c1
Sequence:CCGGCCAACAATGAACACATTATTTCTCGAGAAATAATGTGTTCATTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024803.1-1383s1c1
Sequence:CCGGGCATGTATGATGGGTGCAAATCTCGAGATTTGCACCCATCATACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-800s1c1
Sequence:CCGGCCCTTGAATGTAGACCTAATTCTCGAGAATTAGGTCTACATTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-683s1c1
Sequence:CCGGGCCGTCTATGATATATGCCATCTCGAGATGGCATATATCATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-501s1c1
Sequence:CCGGCAGGGTTTACGTCTCTCTTAACTCGAGTTAAGAGAGACGTAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-274s1c1
Sequence:CCGGGCCAACTGTTATAGATGGGATCTCGAGATCCCATCTATAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024803
TUBAL3 MISSION shRNA shRNA Plasmid DNA
tubulin, alpha-like 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024803.2-596s21c1
Sequence:CCGGTGCTGTGGTAGAGCCTTATAACTCGAGTTATAAGGCTCTACCACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024803.2-725s21c1
Sequence:CCGGCTCTCATGCCAGCATCAATAGCTCGAGCTATTGATGCTGGCATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024803.2-1535s21c1
Sequence:CCGGCCAACAATGAACACATTATTTCTCGAGAAATAATGTGTTCATTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024803.1-1383s1c1
Sequence:CCGGGCATGTATGATGGGTGCAAATCTCGAGATTTGCACCCATCATACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-800s1c1
Sequence:CCGGCCCTTGAATGTAGACCTAATTCTCGAGAATTAGGTCTACATTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-683s1c1
Sequence:CCGGGCCGTCTATGATATATGCCATCTCGAGATGGCATATATCATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-501s1c1
Sequence:CCGGCAGGGTTTACGTCTCTCTTAACTCGAGTTAAGAGAGACGTAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-274s1c1
Sequence:CCGGGCCAACTGTTATAGATGGGATCTCGAGATCCCATCTATAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024803
TUBAL3 MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha-like 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024803.2-596s21c1
Sequence:CCGGTGCTGTGGTAGAGCCTTATAACTCGAGTTATAAGGCTCTACCACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024803.2-725s21c1
Sequence:CCGGCTCTCATGCCAGCATCAATAGCTCGAGCTATTGATGCTGGCATGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024803.2-1535s21c1
Sequence:CCGGCCAACAATGAACACATTATTTCTCGAGAAATAATGTGTTCATTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024803.1-1383s1c1
Sequence:CCGGGCATGTATGATGGGTGCAAATCTCGAGATTTGCACCCATCATACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-800s1c1
Sequence:CCGGCCCTTGAATGTAGACCTAATTCTCGAGAATTAGGTCTACATTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-683s1c1
Sequence:CCGGGCCGTCTATGATATATGCCATCTCGAGATGGCATATATCATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-501s1c1
Sequence:CCGGCAGGGTTTACGTCTCTCTTAACTCGAGTTAAGAGAGACGTAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024803.1-274s1c1
Sequence:CCGGGCCAACTGTTATAGATGGGATCTCGAGATCCCATCTATAACAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_138401
TUBAL3 MISSION shRNA Bacterial Glycerol Stock
tubulin, alpha-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-831s1c1
Sequence:CCGGCCAACCTAGTACCTTATCCAACTCGAGTTGGATAAGGTACTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-639s1c1
Sequence:CCGGCCACCATAGAATACTCAGATTCTCGAGAATCTGAGTATTCTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-499s1c1
Sequence:CCGGGTCGGGATTTACATCTCTCTTCTCGAGAAGAGAGATGTAAATCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-314s1c1
Sequence:CCGGTCACTCTTCCACCCAGAACAACTCGAGTTGTTCTGGGTGGAAGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-149s1c1
Sequence:CCGGCTGGACCATCAACATGATAATCTCGAGATTATCATGTTGATGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_138401
TUBAL3 MISSION shRNA shRNA Plasmid DNA
tubulin, alpha-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-831s1c1
Sequence:CCGGCCAACCTAGTACCTTATCCAACTCGAGTTGGATAAGGTACTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-639s1c1
Sequence:CCGGCCACCATAGAATACTCAGATTCTCGAGAATCTGAGTATTCTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-499s1c1
Sequence:CCGGGTCGGGATTTACATCTCTCTTCTCGAGAAGAGAGATGTAAATCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-314s1c1
Sequence:CCGGTCACTCTTCCACCCAGAACAACTCGAGTTGTTCTGGGTGGAAGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-149s1c1
Sequence:CCGGCTGGACCATCAACATGATAATCTCGAGATTATCATGTTGATGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_138401
TUBAL3 MISSION shRNA Lentiviral Transduction Particles
tubulin, alpha-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-831s1c1
Sequence:CCGGCCAACCTAGTACCTTATCCAACTCGAGTTGGATAAGGTACTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-639s1c1
Sequence:CCGGCCACCATAGAATACTCAGATTCTCGAGAATCTGAGTATTCTATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-499s1c1
Sequence:CCGGGTCGGGATTTACATCTCTCTTCTCGAGAAGAGAGATGTAAATCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-314s1c1
Sequence:CCGGTCACTCTTCCACCCAGAACAACTCGAGTTGTTCTGGGTGGAAGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138401.3-149s1c1
Sequence:CCGGCTGGACCATCAACATGATAATCTCGAGATTATCATGTTGATGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks