EMAIL THIS PAGE TO A FRIEND

TUBB1

tubulin, beta 1 class VI

UniProtKB ID: Q9H4B7
Gene ID:
Human(81027) Summary: This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]
Mouse(545486) tubulin, beta 1 class VI
Rat(679312) tubulin, beta 1 class VI
cow(541271) tubulin, beta 1 class VI
naked mole-rat(101720612) tubulin, beta 1 class VI
domestic guinea pig(100713236) tubulin, beta 1 class VI
Zebrafish(558552) tubulin, beta 1 class VI
dog(485950) tubulin, beta 1 class VI
domestic cat(100188929) tubulin, beta 1 class VI
Horse(100056684) tubulin, beta 1 class VI
chicken(396427) tubulin, beta 1 class VI
Gene Class: Cytoskeleton
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701735 Anti-LOC558552 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB1306542 ANTI-TBB1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1306214 ANTI-TBB1(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1408037 Anti-TUBB1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
western blot pricing
SAB1411464 Anti-TUBB1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
T0198 Monoclonal Anti-β-Tubulin antibody produced in mouse clone D66, purified from hybridoma cell culture Chlamydomonas reinhardtii, canine, rabbit, sea urchin (Lytechinus pictus and Paracentrotus lividus), bovine, hamster, rat, chicken, human, monkey, mouse, Oxyrrhis marina (dinoflagellate)
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
T4026 Monoclonal Anti-β-Tubulin antibody produced in mouse clone TUB 2.1, ascites fluid chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunofluorescence, western blot pricing
T5293 Monoclonal Anti-β-Tubulin antibody produced in mouse clone 2-28-33, ascites fluid rat, chicken, bovine, Caenorhabditis elegans, Strongylocentrotus purpuratus, Ciona intestinalis, human
immunofluorescence, western blot pricing
T5201 Monoclonal Anti-β-Tubulin antibody produced in mouse clone TUB 2.1, purified from hybridoma cell culture chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunoelectrophoresis, immunofluorescence, immunohistochemistry, microarray, western blot pricing
T8535 Monoclonal Anti-β-Tubulin I+II antibody produced in mouse clone JDR.3B8, ascites fluid pig, mouse, rat, chicken, human, bovine
ELISA, immunofluorescence, microarray, western blot pricing
C4585 Monoclonal Anti-β-Tubulin−Cy3 antibody produced in mouse clone TUB 2.1, purified immunoglobulin, buffered aqueous solution chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunofluorescence pricing
F2043 Monoclonal Anti-β-Tubulin−FITC antibody produced in mouse clone TUB 2.1, purified immunoglobulin, buffered aqueous solution chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunofluorescence pricing
SAB1305568 MONOCLONAL ANTI-TBB1 antibody produced in mouse clone 86CT4.4.4, IgG fraction of antiserum, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030773 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030773 Rosetta Predictions human pricing
XM_001055765 Rosetta Predictions rat pricing
NM_001080971 Rosetta Predictions mouse pricing
XM_619851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050800 predicted 1546
2 SASI_Hs02_00358316 predicted 1283
3 SASI_Hs01_00050801 predicted 498
4 SASI_Hs01_00050802 predicted 449
5 SASI_Hs01_00050803 predicted 1649
6 SASI_Hs01_00050804 predicted 491
7 SASI_Hs01_00050805 predicted 1599
8 SASI_Hs01_00050807 predicted 267
9 SASI_Hs01_00050808 predicted 827
10 SASI_Hs01_00050809 predicted 1138
11 SASI_Hs01_00050806 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280934 predicted 529
2 SASI_Rn02_00280935 predicted 1146
3 SASI_Rn02_00280936 predicted 891
4 SASI_Rn02_00280937 predicted 1138
5 SASI_Rn02_00280938 predicted 610
6 SASI_Rn02_00280939 predicted 973
7 SASI_Rn02_00280940 predicted 286
8 SASI_Rn02_00280941 predicted 1008
9 SASI_Rn02_00280942 predicted 664
10 SASI_Rn02_00280943 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294196 predicted 197
2 SASI_Mm02_00294197 predicted 1065
3 SASI_Mm02_00294198 predicted 967
4 SASI_Mm02_00294199 predicted 531
5 SASI_Mm02_00294200 predicted 293
6 SASI_Mm02_00294201 predicted 280
7 SASI_Mm02_00294202 predicted 325
8 SASI_Mm02_00294203 predicted 611
9 SASI_Mm02_00294204 predicted 1051
10 SASI_Mm02_00294205 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211400 predicted 208
2 SASI_Mm01_00211401 predicted 1070
3 SASI_Mm01_00211402 predicted 979
4 SASI_Mm01_00211403 predicted 532
5 SASI_Mm01_00211404 predicted 297
6 SASI_Mm01_00211405 predicted 292
7 SASI_Mm01_00211406 predicted 333
8 SASI_Mm01_00211407 predicted 611
9 SASI_Mm01_00211408 predicted 1284
10 SASI_Mm01_00211409 predicted 1029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080971
TUBB1 MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 1 class VI
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-286s21c1
Sequence:CCGGGCAGATTGGGAGTCCTCTTTCCTCGAGGAAAGAGGACTCCCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-532s21c1
Sequence:CCGGATCGGATCTTGAACTCCTTTACTCGAGTAAAGGAGTTCAAGATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-1145s21c1
Sequence:CCGGTACCTTCCTGGGCAACAATACCTCGAGGTATTGTTGCCCAGGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-978s21c1
Sequence:CCGGTACCTGACTGTGGCTTGTATACTCGAGTATACAAGCCACAGTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-661s21c1
Sequence:CCGGACGAAGCGCTCTATGACATTTCTCGAGAAATGTCATAGAGCGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080971
TUBB1 MISSION shRNA shRNA Plasmid DNA
tubulin, beta 1 class VI
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-286s21c1
Sequence:CCGGGCAGATTGGGAGTCCTCTTTCCTCGAGGAAAGAGGACTCCCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-532s21c1
Sequence:CCGGATCGGATCTTGAACTCCTTTACTCGAGTAAAGGAGTTCAAGATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-1145s21c1
Sequence:CCGGTACCTTCCTGGGCAACAATACCTCGAGGTATTGTTGCCCAGGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-978s21c1
Sequence:CCGGTACCTGACTGTGGCTTGTATACTCGAGTATACAAGCCACAGTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-661s21c1
Sequence:CCGGACGAAGCGCTCTATGACATTTCTCGAGAAATGTCATAGAGCGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080971
TUBB1 MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 1 class VI
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-286s21c1
Sequence:CCGGGCAGATTGGGAGTCCTCTTTCCTCGAGGAAAGAGGACTCCCAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-532s21c1
Sequence:CCGGATCGGATCTTGAACTCCTTTACTCGAGTAAAGGAGTTCAAGATCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-1145s21c1
Sequence:CCGGTACCTTCCTGGGCAACAATACCTCGAGGTATTGTTGCCCAGGAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-978s21c1
Sequence:CCGGTACCTGACTGTGGCTTGTATACTCGAGTATACAAGCCACAGTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080971.1-661s21c1
Sequence:CCGGACGAAGCGCTCTATGACATTTCTCGAGAAATGTCATAGAGCGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030773
VALIDATED
TUBB1 MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 1 class VI
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-1474s21c1
Sequence:GTACCGGGGATGGACATAAACGAATTTGCTCGAGCAAATTCGTTTATGTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-3248s21c1
Sequence:CCGGGACTTACAGCCTGCGATTATACTCGAGTATAATCGCAGGCTGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-492s21c1
Sequence:CCGGAGCATTCGATCTAGCAAATTACTCGAGTAATTTGCTAGATCGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-1525s21c1
Sequence:CCGGTATCCGAGTACCAACAATTTCCTCGAGGAAATTGTTGGTACTCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-959s21c1
Sequence:CCGGCTTGACCATGAGCGGCATAACCTCGAGGTTATGCCGCTCATGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030773.2-3257s1c1
Sequence:CCGGCCTGCGATTATACAAGGATTTCTCGAGAAATCCTTGTATAATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-1535s1c1
Sequence:CCGGCCAACAATTTCAAGATGCCAACTCGAGTTGGCATCTTGAAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-1514s1c1
Sequence:CCGGCCATGATTTGGTATCCGAGTACTCGAGTACTCGGATACCAAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-517s1c1
Sequence:CCGGCTCTCTTTCAACCCGACAGTTCTCGAGAACTGTCGGGTTGAAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-489s1c1
Sequence:CCGGGACAGCATTCGATCTAGCAAACTCGAGTTTGCTAGATCGAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030773
VALIDATED
TUBB1 MISSION shRNA shRNA Plasmid DNA
tubulin, beta 1 class VI
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-1474s21c1
Sequence:GTACCGGGGATGGACATAAACGAATTTGCTCGAGCAAATTCGTTTATGTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-3248s21c1
Sequence:CCGGGACTTACAGCCTGCGATTATACTCGAGTATAATCGCAGGCTGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-492s21c1
Sequence:CCGGAGCATTCGATCTAGCAAATTACTCGAGTAATTTGCTAGATCGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-1525s21c1
Sequence:CCGGTATCCGAGTACCAACAATTTCCTCGAGGAAATTGTTGGTACTCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-959s21c1
Sequence:CCGGCTTGACCATGAGCGGCATAACCTCGAGGTTATGCCGCTCATGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030773.2-3257s1c1
Sequence:CCGGCCTGCGATTATACAAGGATTTCTCGAGAAATCCTTGTATAATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-1535s1c1
Sequence:CCGGCCAACAATTTCAAGATGCCAACTCGAGTTGGCATCTTGAAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-1514s1c1
Sequence:CCGGCCATGATTTGGTATCCGAGTACTCGAGTACTCGGATACCAAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-517s1c1
Sequence:CCGGCTCTCTTTCAACCCGACAGTTCTCGAGAACTGTCGGGTTGAAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-489s1c1
Sequence:CCGGGACAGCATTCGATCTAGCAAACTCGAGTTTGCTAGATCGAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030773
VALIDATED
TUBB1 MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 1 class VI
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-1474s21c1
Sequence:GTACCGGGGATGGACATAAACGAATTTGCTCGAGCAAATTCGTTTATGTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-3248s21c1
Sequence:CCGGGACTTACAGCCTGCGATTATACTCGAGTATAATCGCAGGCTGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-492s21c1
Sequence:CCGGAGCATTCGATCTAGCAAATTACTCGAGTAATTTGCTAGATCGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-1525s21c1
Sequence:CCGGTATCCGAGTACCAACAATTTCCTCGAGGAAATTGTTGGTACTCGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_030773.2-959s21c1
Sequence:CCGGCTTGACCATGAGCGGCATAACCTCGAGGTTATGCCGCTCATGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030773.2-3257s1c1
Sequence:CCGGCCTGCGATTATACAAGGATTTCTCGAGAAATCCTTGTATAATCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-1535s1c1
Sequence:CCGGCCAACAATTTCAAGATGCCAACTCGAGTTGGCATCTTGAAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-1514s1c1
Sequence:CCGGCCATGATTTGGTATCCGAGTACTCGAGTACTCGGATACCAAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-517s1c1
Sequence:CCGGCTCTCTTTCAACCCGACAGTTCTCGAGAACTGTCGGGTTGAAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030773.2-489s1c1
Sequence:CCGGGACAGCATTCGATCTAGCAAACTCGAGTTTGCTAGATCGAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks