EMAIL THIS PAGE TO A FRIEND

TUBB2A

tubulin, beta 2A class IIa

Synonyms: TUBB TUBB2 dJ40E16.7
UniProtKB ID: Q13885, Q6FGZ8, Q8IWR2
Gene ID:
Mouse(22151) tubulin, beta 2A class IIA
Rat(498736) tubulin, beta 2A class IIa
dog(478701) tubulin, beta 2A class IIa
Horse(100051013) tubulin, beta 2A class IIa
domestic cat(101087402) tubulin, beta 2A class IIa
domestic guinea pig(100731652) tubulin, beta 2A class IIa
naked mole-rat(101726751) tubulin, beta 2A class IIa
Domestic Rabbit(100349792) tubulin, beta 2A class IIa
sheep(100303606) tubulin, beta 2A class IIa
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107973 Anti-TUBB2A antibody produced in rabbit affinity isolated antibody rat, Arabidopsis sp., sheep, human, mouse
immunohistochemistry, western blot pricing
AV40177 Anti-TUBB2A antibody produced in rabbit affinity isolated antibody, lyophilized powder Arabidopsis sp., mouse, human, rat
western blot pricing
SAB2103181 Anti-TUBB2A, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, human, bovine, rat, canine, pig, horse, rabbit, guinea pig, sheep
western blot pricing
T3526 Anti-Tubulin antibody produced in rabbit whole antiserum mouse, chicken
immunofluorescence, western blot pricing
T0198 Monoclonal Anti-β-Tubulin antibody produced in mouse clone D66, purified from hybridoma cell culture Chlamydomonas reinhardtii, canine, rabbit, sea urchin (Lytechinus pictus and Paracentrotus lividus), bovine, hamster, rat, chicken, human, monkey, mouse, Oxyrrhis marina (dinoflagellate)
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
T4026 Monoclonal Anti-β-Tubulin antibody produced in mouse clone TUB 2.1, ascites fluid chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunofluorescence, western blot pricing
T5293 Monoclonal Anti-β-Tubulin antibody produced in mouse clone 2-28-33, ascites fluid rat, chicken, bovine, Caenorhabditis elegans, Strongylocentrotus purpuratus, Ciona intestinalis, human
immunofluorescence, western blot pricing
T5201 Monoclonal Anti-β-Tubulin antibody produced in mouse clone TUB 2.1, purified from hybridoma cell culture chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunoelectrophoresis, immunofluorescence, immunohistochemistry, microarray, western blot pricing
T8535 Monoclonal Anti-β-Tubulin I+II antibody produced in mouse clone JDR.3B8, ascites fluid pig, mouse, rat, chicken, human, bovine
ELISA, immunofluorescence, microarray, western blot pricing
C4585 Monoclonal Anti-β-Tubulin−Cy3 antibody produced in mouse clone TUB 2.1, purified immunoglobulin, buffered aqueous solution chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunofluorescence pricing
F2043 Monoclonal Anti-β-Tubulin−FITC antibody produced in mouse clone TUB 2.1, purified immunoglobulin, buffered aqueous solution chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunofluorescence pricing
SAB1404497 Monoclonal Anti-TUBB2A antibody produced in mouse clone 3B2, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1402386 Monoclonal Anti-TUBB2A antibody produced in mouse clone 2B2, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing
AQ0828 AQUA Peptide EIVHIQAGQ(CAM)GNQIGA[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091271 MISSION® esiRNA esiRNA targeting mouse Tubb2a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001069 Rosetta Predictions human pricing
NM_001109119 Rosetta Predictions rat pricing
NM_009450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311876 predicted 312
2 SASI_Hs02_00311877 predicted 360
3 SASI_Hs02_00311878 predicted 669
4 SASI_Hs02_00311879 predicted 459
5 SASI_Hs01_00141152 predicted 950
6 SASI_Hs02_00311880 predicted 671
7 SASI_Hs01_00141158 predicted 1582
8 SASI_Hs01_00141159 predicted 1450
9 SASI_Hs01_00141160 predicted 1461
10 SASI_Hs02_00311881 predicted 1450
11 SASI_Hs01_00141151 predicted 1163
12 SASI_Hs01_00141153 predicted 959
13 SASI_Hs01_00141154 predicted 935
14 SASI_Hs01_00141155 predicted 1169
15 SASI_Hs01_00141156 predicted 968
16 SASI_Hs01_00141157 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245310 predicted 605
2 SASI_Rn02_00245311 predicted 656
3 SASI_Rn02_00245312 predicted 664
4 SASI_Rn02_00245313 predicted 378
5 SASI_Rn02_00245314 predicted 686
6 SASI_Rn02_00245315 predicted 733
7 SASI_Rn02_00245316 predicted 664
8 SASI_Rn02_00245317 predicted 443
9 SASI_Rn02_00245318 predicted 600
10 SASI_Rn02_00245319 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197737 predicted 295
2 SASI_Mm01_00197738 predicted 287
3 SASI_Mm01_00197734 predicted 653
4 SASI_Mm01_00197735 predicted 655
5 SASI_Mm01_00197736 predicted 658
6 SASI_Mm02_00316157 predicted 1496
7 SASI_Mm01_00197741 predicted 1452
8 SASI_Mm01_00197739 predicted 1493
9 SASI_Mm01_00197740 predicted 1455
10 SASI_Mm01_00197742 predicted 1414
11 SASI_Mm01_00197743 predicted 1401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001069
VALIDATED
TUBB2A MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 2A class IIa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-1464s1c1
Sequence:CCGGGTTGTCCTCAAGCATGGTCTTCTCGAGAAGACCATGCTTGAGGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001069.2-231s1c1
Sequence:CCGGGTGTACTACAATGAGGCTGCTCTCGAGAGCAGCCTCATTGTAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-671s1c1
Sequence:CCGGCACAGATGAAACCTACTCCATCTCGAGATGGAGTAGGTTTCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-215s1c1
Sequence:CCGGGCTGGAGAGAATCAACGTGTACTCGAGTACACGTTGATTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-246s1c1
Sequence:CCGGGCTGCTGGTAACAAATATGTACTCGAGTACATATTTGTTACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001069.2-671s21c1
Sequence:CCGGCACAGATGAAACCTACTCCATCTCGAGATGGAGTAGGTTTCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001069.2-231s21c1
Sequence:CCGGGTGTACTACAATGAGGCTGCTCTCGAGAGCAGCCTCATTGTAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001069.2-1464s21c1
Sequence:CCGGGTTGTCCTCAAGCATGGTCTTCTCGAGAAGACCATGCTTGAGGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001069.2-215s21c1
Sequence:CCGGGCTGGAGAGAATCAACGTGTACTCGAGTACACGTTGATTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001069.2-246s21c1
Sequence:CCGGGCTGCTGGTAACAAATATGTACTCGAGTACATATTTGTTACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001069
VALIDATED
TUBB2A MISSION shRNA shRNA Plasmid DNA
tubulin, beta 2A class IIa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-1464s1c1
Sequence:CCGGGTTGTCCTCAAGCATGGTCTTCTCGAGAAGACCATGCTTGAGGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001069.2-231s1c1
Sequence:CCGGGTGTACTACAATGAGGCTGCTCTCGAGAGCAGCCTCATTGTAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-671s1c1
Sequence:CCGGCACAGATGAAACCTACTCCATCTCGAGATGGAGTAGGTTTCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-215s1c1
Sequence:CCGGGCTGGAGAGAATCAACGTGTACTCGAGTACACGTTGATTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-246s1c1
Sequence:CCGGGCTGCTGGTAACAAATATGTACTCGAGTACATATTTGTTACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001069.2-671s21c1
Sequence:CCGGCACAGATGAAACCTACTCCATCTCGAGATGGAGTAGGTTTCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001069.2-231s21c1
Sequence:CCGGGTGTACTACAATGAGGCTGCTCTCGAGAGCAGCCTCATTGTAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001069.2-1464s21c1
Sequence:CCGGGTTGTCCTCAAGCATGGTCTTCTCGAGAAGACCATGCTTGAGGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001069.2-215s21c1
Sequence:CCGGGCTGGAGAGAATCAACGTGTACTCGAGTACACGTTGATTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001069.2-246s21c1
Sequence:CCGGGCTGCTGGTAACAAATATGTACTCGAGTACATATTTGTTACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001069
VALIDATED
TUBB2A MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 2A class IIa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-1464s1c1
Sequence:CCGGGTTGTCCTCAAGCATGGTCTTCTCGAGAAGACCATGCTTGAGGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001069.2-231s1c1
Sequence:CCGGGTGTACTACAATGAGGCTGCTCTCGAGAGCAGCCTCATTGTAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-671s1c1
Sequence:CCGGCACAGATGAAACCTACTCCATCTCGAGATGGAGTAGGTTTCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-215s1c1
Sequence:CCGGGCTGGAGAGAATCAACGTGTACTCGAGTACACGTTGATTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001069.2-246s1c1
Sequence:CCGGGCTGCTGGTAACAAATATGTACTCGAGTACATATTTGTTACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001069.2-671s21c1
Sequence:CCGGCACAGATGAAACCTACTCCATCTCGAGATGGAGTAGGTTTCATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001069.2-231s21c1
Sequence:CCGGGTGTACTACAATGAGGCTGCTCTCGAGAGCAGCCTCATTGTAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001069.2-1464s21c1
Sequence:CCGGGTTGTCCTCAAGCATGGTCTTCTCGAGAAGACCATGCTTGAGGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001069.2-215s21c1
Sequence:CCGGGCTGGAGAGAATCAACGTGTACTCGAGTACACGTTGATTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001069.2-246s21c1
Sequence:CCGGGCTGCTGGTAACAAATATGTACTCGAGTACATATTTGTTACCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009450
VALIDATED
TUBB2A MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 2A class IIa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-1458s1c1
Sequence:CCGGGCATGGTCTTTCTATTTGTAACTCGAGTTACAAATAGAAAGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-1068s1c1
Sequence:CCGGGCAGAACAAGAACAGCAGCTACTCGAGTAGCTGCTGTTCTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-229s1c1
Sequence:CCGGGCTGCTGGCAACAAATATGTACTCGAGTACATATTTGTTGCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-661s1c1
Sequence:CCGGGAAACCTATTCCATTGACAATCTCGAGATTGTCAATGGAATAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-232s1c1
Sequence:CCGGGCTGGCAACAAATATGTACCTCTCGAGAGGTACATATTTGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009450.1-1458s21c1
Sequence:CCGGGCATGGTCTTTCTATTTGTAACTCGAGTTACAAATAGAAAGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009450.1-1390s21c1
Sequence:CCGGGGTGAAGATGAGGCTTGAGAACTCGAGTTCTCAAGCCTCATCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009450.1-129s21c1
Sequence:CCGGTTGGGAGGTGATAAGCGATGACTCGAGTCATCGCTTATCACCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009450.1-1431s21c1
Sequence:CCGGCCCTTAGTGAACTTCTGTTGTCTCGAGACAACAGAAGTTCACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009450.1-1417s21c1
Sequence:CCGGAGATACAATGTGCACCCTTAGCTCGAGCTAAGGGTGCACATTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009450
VALIDATED
TUBB2A MISSION shRNA shRNA Plasmid DNA
tubulin, beta 2A class IIa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-1458s1c1
Sequence:CCGGGCATGGTCTTTCTATTTGTAACTCGAGTTACAAATAGAAAGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-1068s1c1
Sequence:CCGGGCAGAACAAGAACAGCAGCTACTCGAGTAGCTGCTGTTCTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-229s1c1
Sequence:CCGGGCTGCTGGCAACAAATATGTACTCGAGTACATATTTGTTGCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-661s1c1
Sequence:CCGGGAAACCTATTCCATTGACAATCTCGAGATTGTCAATGGAATAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-232s1c1
Sequence:CCGGGCTGGCAACAAATATGTACCTCTCGAGAGGTACATATTTGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009450.1-1458s21c1
Sequence:CCGGGCATGGTCTTTCTATTTGTAACTCGAGTTACAAATAGAAAGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009450.1-1390s21c1
Sequence:CCGGGGTGAAGATGAGGCTTGAGAACTCGAGTTCTCAAGCCTCATCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009450.1-129s21c1
Sequence:CCGGTTGGGAGGTGATAAGCGATGACTCGAGTCATCGCTTATCACCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009450.1-1431s21c1
Sequence:CCGGCCCTTAGTGAACTTCTGTTGTCTCGAGACAACAGAAGTTCACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009450.1-1417s21c1
Sequence:CCGGAGATACAATGTGCACCCTTAGCTCGAGCTAAGGGTGCACATTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009450
VALIDATED
TUBB2A MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 2A class IIa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-1458s1c1
Sequence:CCGGGCATGGTCTTTCTATTTGTAACTCGAGTTACAAATAGAAAGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-1068s1c1
Sequence:CCGGGCAGAACAAGAACAGCAGCTACTCGAGTAGCTGCTGTTCTTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-229s1c1
Sequence:CCGGGCTGCTGGCAACAAATATGTACTCGAGTACATATTTGTTGCCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-661s1c1
Sequence:CCGGGAAACCTATTCCATTGACAATCTCGAGATTGTCAATGGAATAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009450.1-232s1c1
Sequence:CCGGGCTGGCAACAAATATGTACCTCTCGAGAGGTACATATTTGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009450.1-1458s21c1
Sequence:CCGGGCATGGTCTTTCTATTTGTAACTCGAGTTACAAATAGAAAGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009450.1-1390s21c1
Sequence:CCGGGGTGAAGATGAGGCTTGAGAACTCGAGTTCTCAAGCCTCATCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009450.1-129s21c1
Sequence:CCGGTTGGGAGGTGATAAGCGATGACTCGAGTCATCGCTTATCACCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009450.1-1431s21c1
Sequence:CCGGCCCTTAGTGAACTTCTGTTGTCTCGAGACAACAGAAGTTCACTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009450.1-1417s21c1
Sequence:CCGGAGATACAATGTGCACCCTTAGCTCGAGCTAAGGGTGCACATTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks