EMAIL THIS PAGE TO A FRIEND

TUBB2B

tubulin, beta 2B class IIb

Synonyms: PMGYSA bA506K6.1
UniProtKB ID: Q9BVA1, A8K068
Gene ID:
Human(347733) Summary: The protein encoded by this gene is a beta isoform of tubulin, which binds GTP and is a major component of microtubules. This gene is highly similar to TUBB2A and TUBB2C. Defects in this gene are a cause of asymmetric polymicrogyria. [provided by RefSeq, Mar 2010]
Mouse(73710) tubulin, beta 2B class IIB
Rat(291081) tubulin, beta 2B class IIb
cow(281555) tubulin, beta 2B class IIb
sheep(101122734) tubulin, beta 2B class IIb
Zebrafish(322003) tubulin, beta 2b
domestic cat(101084876) tubulin, beta 2B class IIb
dog(478702) tubulin, beta 2B class IIb
chicken(420883) tubulin, beta 2B class IIb
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1402092 Anti-TUBB2B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
T3526 Anti-Tubulin antibody produced in rabbit whole antiserum mouse, chicken
immunofluorescence, western blot pricing
T8453 Monoclonal Anti-β-Tubulin II antibody produced in mouse ~1.0 mg/mL, clone 7B9, purified immunoglobulin, buffered aqueous solution mouse, human, rat
immunocytochemistry, immunoprecipitation, western blot pricing
T9822 Monoclonal Anti-Tubulin, Polyglutamylated antibody produced in mouse clone B3, purified from hybridoma cell culture mouse, Oxyrrhis marina (dinoflagellate), sea urchin (Lytechinus pictus and three others.), chicken, human, bovine, rabbit, rat, monkey
ELISA, immunocytochemistry, microarray, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing
AQ0828 AQUA Peptide EIVHIQAGQ(CAM)GNQIGA[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178012 Rosetta Predictions human pricing
NM_001013886 Rosetta Predictions rat pricing
NM_023716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369487 predicted 249
2 SASI_Hs02_00369488 predicted 222
3 SASI_Hs01_00233600 predicted 683
4 SASI_Hs02_00369489 predicted 225
5 SASI_Hs02_00369490 predicted 368
6 SASI_Hs02_00369491 predicted 279
7 SASI_Hs02_00369492 predicted 320
8 SASI_Hs02_00369493 predicted 471
9 SASI_Hs01_00233592 predicted 963
10 SASI_Hs02_00369494 predicted 680
11 SASI_Hs01_00233591 predicted 1170
12 SASI_Hs01_00233593 predicted 972
13 SASI_Hs01_00233594 predicted 937
14 SASI_Hs01_00233595 predicted 1173
15 SASI_Hs01_00233596 predicted 976
16 SASI_Hs01_00233597 predicted 962
17 SASI_Hs01_00233598 predicted 163
18 SASI_Hs01_00233599 predicted 1802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054724 predicted 622
2 SASI_Rn02_00201162 predicted 334
3 SASI_Rn01_00054725 predicted 392
4 SASI_Rn01_00054726 predicted 711
5 SASI_Rn01_00054727 predicted 748
6 SASI_Rn02_00201163 predicted 434
7 SASI_Rn01_00054729 predicted 457
8 SASI_Rn02_00201164 predicted 627
9 SASI_Rn01_00054730 predicted 601
10 SASI_Rn02_00201165 predicted 378
11 SASI_Rn01_00054728 predicted 880
12 SASI_Rn01_00054731 predicted 240
13 SASI_Rn01_00054732 predicted 235
14 SASI_Rn01_00054733 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164795 predicted 703
2 SASI_Mm01_00164796 predicted 720
3 SASI_Mm01_00164797 predicted 364
4 SASI_Mm01_00164798 predicted 327
5 SASI_Mm01_00164801 predicted 1541
6 SASI_Mm01_00164799 predicted 703
7 SASI_Mm01_00164800 predicted 725
8 SASI_Mm01_00164802 predicted 191
9 SASI_Mm01_00164803 predicted 1532
10 SASI_Mm01_00164804 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178012
TUBB2B MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 2B class IIb
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178012.4-1766s21c1
Sequence:CCGGATAAACGTTTGTGTCGGAATGCTCGAGCATTCCGACACAAACGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-346s21c1
Sequence:CCGGATGAAGCCACTGGTAACAAATCTCGAGATTTGTTACCAGTGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-1271s21c1
Sequence:CCGGCCTGAAGATGTCGGCCACCTTCTCGAGAAGGTGGCCGACATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178012.4-1706s21c1
Sequence:CCGGGATGACATCAATGTAACATTTCTCGAGAAATGTTACATTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-401s21c1
Sequence:CCGGAGGCACGATGGATTCGGTTAGCTCGAGCTAACCGAATCCATCGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-331s21c1
Sequence:CCGGTCAATGTTTACTACAATGAAGCTCGAGCTTCATTGTAGTAAACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178012.3-1691s1c1
Sequence:CCGGGTCCTCTCTTTCTCTTCCTTTCTCGAGAAAGGAAGAGAAAGAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178012.3-350s1c1
Sequence:CCGGAGACCAGACAATTTCGTGTTTCTCGAGAAACACGAAATTGTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178012.3-1174s1c1
Sequence:CCGGCCTGAAGATGTCGGCCACCTTCTCGAGAAGGTGGCCGACATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178012.3-223s1c1
Sequence:CCGGGCTGGAGAGAATCAATGTTTACTCGAGTAAACATTGATTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178012
TUBB2B MISSION shRNA shRNA Plasmid DNA
tubulin, beta 2B class IIb
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178012.4-1766s21c1
Sequence:CCGGATAAACGTTTGTGTCGGAATGCTCGAGCATTCCGACACAAACGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-346s21c1
Sequence:CCGGATGAAGCCACTGGTAACAAATCTCGAGATTTGTTACCAGTGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-1271s21c1
Sequence:CCGGCCTGAAGATGTCGGCCACCTTCTCGAGAAGGTGGCCGACATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178012.4-1706s21c1
Sequence:CCGGGATGACATCAATGTAACATTTCTCGAGAAATGTTACATTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-401s21c1
Sequence:CCGGAGGCACGATGGATTCGGTTAGCTCGAGCTAACCGAATCCATCGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-331s21c1
Sequence:CCGGTCAATGTTTACTACAATGAAGCTCGAGCTTCATTGTAGTAAACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178012.3-1691s1c1
Sequence:CCGGGTCCTCTCTTTCTCTTCCTTTCTCGAGAAAGGAAGAGAAAGAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178012.3-350s1c1
Sequence:CCGGAGACCAGACAATTTCGTGTTTCTCGAGAAACACGAAATTGTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178012.3-1174s1c1
Sequence:CCGGCCTGAAGATGTCGGCCACCTTCTCGAGAAGGTGGCCGACATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178012.3-223s1c1
Sequence:CCGGGCTGGAGAGAATCAATGTTTACTCGAGTAAACATTGATTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178012
TUBB2B MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 2B class IIb
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178012.4-1766s21c1
Sequence:CCGGATAAACGTTTGTGTCGGAATGCTCGAGCATTCCGACACAAACGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-346s21c1
Sequence:CCGGATGAAGCCACTGGTAACAAATCTCGAGATTTGTTACCAGTGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-1271s21c1
Sequence:CCGGCCTGAAGATGTCGGCCACCTTCTCGAGAAGGTGGCCGACATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178012.4-1706s21c1
Sequence:CCGGGATGACATCAATGTAACATTTCTCGAGAAATGTTACATTGATGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-401s21c1
Sequence:CCGGAGGCACGATGGATTCGGTTAGCTCGAGCTAACCGAATCCATCGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178012.4-331s21c1
Sequence:CCGGTCAATGTTTACTACAATGAAGCTCGAGCTTCATTGTAGTAAACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178012.3-1691s1c1
Sequence:CCGGGTCCTCTCTTTCTCTTCCTTTCTCGAGAAAGGAAGAGAAAGAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178012.3-350s1c1
Sequence:CCGGAGACCAGACAATTTCGTGTTTCTCGAGAAACACGAAATTGTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178012.3-1174s1c1
Sequence:CCGGCCTGAAGATGTCGGCCACCTTCTCGAGAAGGTGGCCGACATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178012.3-223s1c1
Sequence:CCGGGCTGGAGAGAATCAATGTTTACTCGAGTAAACATTGATTCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023716
TUBB2B MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 2B class IIb
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000090513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023716.1-1772s1c1
Sequence:CCGGCCACCTTTCTGAACACAGAAACTCGAGTTTCTGTGTTCAGAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023716.1-271s1c1
Sequence:CCGGACTACAATGAAGCAACTGGTACTCGAGTACCAGTTGCTTCATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023716.1-356s1c1
Sequence:CCGGTGGACCATTTGGGCAGATCTTCTCGAGAAGATCTGCCCAAATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023716.1-409s1c1
Sequence:CCGGGTGCAGGAAATAACTGGGCAACTCGAGTTGCCCAGTTATTTCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023716
TUBB2B MISSION shRNA shRNA Plasmid DNA
tubulin, beta 2B class IIb
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000090513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023716.1-1772s1c1
Sequence:CCGGCCACCTTTCTGAACACAGAAACTCGAGTTTCTGTGTTCAGAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023716.1-271s1c1
Sequence:CCGGACTACAATGAAGCAACTGGTACTCGAGTACCAGTTGCTTCATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023716.1-356s1c1
Sequence:CCGGTGGACCATTTGGGCAGATCTTCTCGAGAAGATCTGCCCAAATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023716.1-409s1c1
Sequence:CCGGGTGCAGGAAATAACTGGGCAACTCGAGTTGCCCAGTTATTTCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023716
TUBB2B MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 2B class IIb
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000090513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023716.1-1772s1c1
Sequence:CCGGCCACCTTTCTGAACACAGAAACTCGAGTTTCTGTGTTCAGAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023716.1-271s1c1
Sequence:CCGGACTACAATGAAGCAACTGGTACTCGAGTACCAGTTGCTTCATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023716.1-356s1c1
Sequence:CCGGTGGACCATTTGGGCAGATCTTCTCGAGAAGATCTGCCCAAATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023716.1-409s1c1
Sequence:CCGGGTGCAGGAAATAACTGGGCAACTCGAGTTGCCCAGTTATTTCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks