EMAIL THIS PAGE TO A FRIEND

TUBB3

tubulin, beta 3 class III

Synonyms: CDCBM CFEOM3A TUBB4 beta-4
UniProtKB ID: Q13509, Q9BTZ0, Q9BW10
Gene ID:
Human(10381) Summary: This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Oct 2010]
Mouse(22152) tubulin, beta 3 class III
Rat(246118) tubulin, beta 3 class III
chicken(431043) tubulin, beta 3 class III
domestic cat(101083472) tubulin, beta 3 class III
dog(608025) tubulin, beta 3 class III
domestic guinea pig(100732882) tubulin, beta 3 class III
naked mole-rat(101696466) tubulin, beta 3 class III
cow(768070) tubulin, beta 3 class III
sheep(101112756) tubulin, beta 3 class III
Gene Class: Cytoskeleton
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
T2200 Anti-β-Tubulin III antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, immunoprecipitation, western blot pricing
T3952 Anti-β-Tubulin III antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2502108 Anti-TUBB3 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, bovine, rat, pig, human
ELISA, western blot pricing
SAB4500088 Anti-Tubulin β, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4300623 Anti-Tubulin β-III antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
T8578 Monoclonal Anti-β-Tubulin III (neuronal) antibody produced in mouse ~1.0 mg/mL, clone 2G10, purified immunoglobulin, buffered aqueous solution human, mouse, rat
immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
T8660 Monoclonal Anti-β-Tubulin III antibody produced in mouse clone SDL.3D10, ascites fluid boar, rat, human, bovine
ELISA, western blot pricing
T5076 Monoclonal Anti-β-Tubulin Isotype III antibody produced in mouse clone SDL.3D10, purified from hybridoma cell culture human, bovine, rat, mouse, boar
dot blot, ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
SAB3300047 Monoclonal Anti-TUBB3 antibody produced in mouse clone 5H2, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
SAB4700544 Monoclonal Anti-TUBB3 antibody produced in mouse clone TU-20, purified immunoglobulin, buffered aqueous solution wide range
western blot pricing
SAB4700545 Monoclonal Anti-TUBB3-FITC antibody produced in mouse clone TU-20, purified immunoglobulin, buffered aqueous solution wide range
flow cytometry pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing
AQ0828 AQUA Peptide EIVHIQAGQ(CAM)GNQIGA[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006086 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB9354 Anti-Beta III Tubulin Antibody 500 µL, Anti-Beta III Tubulin Antibody detects level of Beta III Tubulin & has been published & validated for use in IC, IH & WB. pricing
AB15708A4 Anti-Beta III Tubulin Antibody, Alexa Fluor® 488 Conjugate | AB15708A4 100 µL pricing
AB15708B Anti-Beta III Tubulin, Biotin conjugate Antibody 100 µL, Anti-Beta III Tubulin, Biotin conjugate Antibody detects level of Beta III Tubulin & has been published & validated for use in ICC. pricing
AB15708C3 Anti-Beta III Tubulin, Cy3 Conjugate Antibody 100 µL, This Anti-Beta III Tubulin, Cy3 Conjugate Antibody is validated for use in ICC for the detection of Beta III Tubulin. pricing
AB15708 Anti-β III tubulin Antibody 100 µg, Anti-β III tubulin Antibody is an antibody against β III tubulin for use in WB. pricing
MAB3408 Anti-Tubulin Antibody, beta, clone KMX-1 50 µg, This Anti-Tubulin Antibody, beta, clone KMX-1 is validated for use in IC, WB for the detection of Tubulin. pricing
MAB1637 Anti-Tubulin Antibody, beta III isoform, CT, clone TU-20 (Similar to TUJ1) 100 µL, Anti-Tubulin Antibody, beta III isoform, C-terminus, clone TU-20 (Similar to TUJ1) is an antibody against Tubulin for use in ELISA, IC, IH, IH(P), IP & WB with more than 55 product citations. pricing
MAB380 Anti-Tubulin β Antibody, clone 5H1 100 µL, Anti-Tubulin Antibody, β, clone 5H1 is an antibody against Tubulin for use in IH. pricing
CBL270 Anti-Tubulin Antibody, clone YOL 1/34 100 µg, Anti-Tubulin Antibody, clone YOL 1/34 detects level of Tubulin & has been published & validated for use in ELISA, WB, IH. pricing
AB3201 Anti-Tubulin Antibody, Detyrosinated 50 µg, Anti-Tubulin Antibody, Detyrosinated is an antibody against Tubulin for use in IC, IH(P) and WB. pricing
MAB5562 Anti-Tubulin β II Antibody 100 µL, Detect Tubulin using this Anti-Tubulin Antibody, β II validated for use in WB, IH. pricing
MAB5564 Anti-Tubulin β III Antibody 100 µg, Anti-Tubulin Antibody, β III detects level of Tubulin & has been published & validated for use in WB, IH. pricing
05-559 Anti-Tubulin βIII Antibody, clone 2G10, neuronal 200 µg, Anti-Tubulin βIII Antibody, clone 2G10, neuronal is an antibody against Tubulin βIII for use in WB & IC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006086 Rosetta Predictions human pricing
NM_139254 Rosetta Predictions rat pricing
XM_579666 Rosetta Predictions rat pricing
NM_023279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057103 predicted 251
2 SASI_Hs01_00057104 predicted 304
3 SASI_Hs01_00057105 predicted 310
4 SASI_Hs01_00057106 predicted 520
5 SASI_Hs01_00057109 predicted 311
6 SASI_Hs01_00057110 predicted 1358
7 SASI_Hs01_00057107 predicted 1142
8 SASI_Hs01_00057108 predicted 763
9 SASI_Hs01_00057111 predicted 193
10 SASI_Hs02_00340864 predicted 197
11 SASI_Hs01_00057112 predicted 116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048041 predicted 322
2 SASI_Rn01_00048042 predicted 344
3 SASI_Rn01_00048043 predicted 490
4 SASI_Rn02_00268535 predicted 773
5 SASI_Rn01_00048046 predicted 295
6 SASI_Rn02_00268536 predicted 1036
7 SASI_Rn01_00048047 predicted 395
8 SASI_Rn01_00048048 predicted 291
9 SASI_Rn01_00048049 predicted 768
10 SASI_Rn01_00048050 predicted 290
11 SASI_Rn01_00048044 predicted 418
12 SASI_Rn01_00048045 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180890 predicted 331
2 SASI_Rn01_00180891 predicted 355
3 SASI_Rn01_00180892 predicted 422
4 SASI_Rn01_00180893 predicted 499
5 SASI_Rn01_00180894 predicted 418
6 SASI_Rn01_00180895 predicted 308
7 SASI_Rn01_00180896 predicted 303
8 SASI_Rn01_00180897 predicted 399
9 SASI_Rn01_00180898 predicted 307
10 SASI_Rn01_00180899 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196877 predicted 760
2 SASI_Mm01_00196880 predicted 601
3 SASI_Mm01_00196875 predicted 395
4 SASI_Mm01_00196876 predicted 317
5 SASI_Mm01_00196878 predicted 284
6 SASI_Mm01_00196879 predicted 394
7 SASI_Mm01_00196881 predicted 290
8 SASI_Mm01_00196882 predicted 1527
9 SASI_Mm01_00196884 predicted 1523
10 SASI_Mm02_00327016 predicted 1551
11 SASI_Mm01_00196883 predicted 180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006086
VALIDATED
TUBB3 MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 3 class III
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-1486s1c1
Sequence:CCGGCAGTATTTATGGCCTCGTCCTCTCGAGAGGACGAGGCCATAAATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-156s1c1
Sequence:CCGGCGAGGCCTCTTCTCACAAGTACTCGAGTACTTGTGAGAAGAGGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-247s1c1
Sequence:CCGGCATCTCTTCAGGCCTGACAATCTCGAGATTGTCAGGCCTGAAGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-699s1c1
Sequence:CCGGGAGCGGAGTCACCACCTCCTTCTCGAGAAGGAGGTGGTGACTCCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-1302s1c1
Sequence:CCGGCGAGATGTACGAAGACGACGACTCGAGTCGTCGTCTTCGTACATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-119s21c1
Sequence:CCGGCAAGTTCTGGGAAGTCATCAGCTCGAGCTGATGACTTCCCAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-538s21c1
Sequence:CCGGAGTATCCCGACCGCATCATGACTCGAGTCATGATGCGGTCGGGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-1146s21c1
Sequence:CCGGCTCAAGATGTCCTCCACCTTCCTCGAGGAAGGTGGAGGACATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006086.2-1460s21c1
Sequence:CCGGCCGAAGCCAGCAGTGTCTAAACTCGAGTTTAGACACTGCTGGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-196s21c1
Sequence:CCGGTGGAGCGGATCAGCGTCTACTCTCGAGAGTAGACGCTGATCCGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006086
VALIDATED
TUBB3 MISSION shRNA shRNA Plasmid DNA
tubulin, beta 3 class III
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-1486s1c1
Sequence:CCGGCAGTATTTATGGCCTCGTCCTCTCGAGAGGACGAGGCCATAAATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-156s1c1
Sequence:CCGGCGAGGCCTCTTCTCACAAGTACTCGAGTACTTGTGAGAAGAGGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-247s1c1
Sequence:CCGGCATCTCTTCAGGCCTGACAATCTCGAGATTGTCAGGCCTGAAGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-699s1c1
Sequence:CCGGGAGCGGAGTCACCACCTCCTTCTCGAGAAGGAGGTGGTGACTCCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-1302s1c1
Sequence:CCGGCGAGATGTACGAAGACGACGACTCGAGTCGTCGTCTTCGTACATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-119s21c1
Sequence:CCGGCAAGTTCTGGGAAGTCATCAGCTCGAGCTGATGACTTCCCAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-538s21c1
Sequence:CCGGAGTATCCCGACCGCATCATGACTCGAGTCATGATGCGGTCGGGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-1146s21c1
Sequence:CCGGCTCAAGATGTCCTCCACCTTCCTCGAGGAAGGTGGAGGACATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006086.2-1460s21c1
Sequence:CCGGCCGAAGCCAGCAGTGTCTAAACTCGAGTTTAGACACTGCTGGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-196s21c1
Sequence:CCGGTGGAGCGGATCAGCGTCTACTCTCGAGAGTAGACGCTGATCCGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006086
VALIDATED
TUBB3 MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 3 class III
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-1486s1c1
Sequence:CCGGCAGTATTTATGGCCTCGTCCTCTCGAGAGGACGAGGCCATAAATACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-156s1c1
Sequence:CCGGCGAGGCCTCTTCTCACAAGTACTCGAGTACTTGTGAGAAGAGGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-247s1c1
Sequence:CCGGCATCTCTTCAGGCCTGACAATCTCGAGATTGTCAGGCCTGAAGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-699s1c1
Sequence:CCGGGAGCGGAGTCACCACCTCCTTCTCGAGAAGGAGGTGGTGACTCCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006086.1-1302s1c1
Sequence:CCGGCGAGATGTACGAAGACGACGACTCGAGTCGTCGTCTTCGTACATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-119s21c1
Sequence:CCGGCAAGTTCTGGGAAGTCATCAGCTCGAGCTGATGACTTCCCAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-538s21c1
Sequence:CCGGAGTATCCCGACCGCATCATGACTCGAGTCATGATGCGGTCGGGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-1146s21c1
Sequence:CCGGCTCAAGATGTCCTCCACCTTCCTCGAGGAAGGTGGAGGACATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006086.2-1460s21c1
Sequence:CCGGCCGAAGCCAGCAGTGTCTAAACTCGAGTTTAGACACTGCTGGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006086.2-196s21c1
Sequence:CCGGTGGAGCGGATCAGCGTCTACTCTCGAGAGTAGACGCTGATCCGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023279
TUBB3 MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 3 class III
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023279.2-1605s1c1
Sequence:CCGGCCTCTGTATTTATGTTGCTTACTCGAGTAAGCAACATAAATACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-399s1c1
Sequence:CCGGCGTGCGGAAAGAGTGTGAGAACTCGAGTTCTCACACTCTTTCCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-1041s1c1
Sequence:CCGGCCAGAGTAAGAACAGCAGCTACTCGAGTAGCTGCTGTTCTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-297s1c1
Sequence:CCGGCAGGCCCGACAACTTTATCTTCTCGAGAAGATAAAGTTGTCGGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-298s1c1
Sequence:CCGGAGGCCCGACAACTTTATCTTTCTCGAGAAAGATAAAGTTGTCGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023279.2-341s21c1
Sequence:CCGGACTGGGCCAAAGGGCACTATACTCGAGTATAGTGCCCTTTGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023279.2-276s21c1
Sequence:CCGGTGGCGCCTTTGGACACCTATTCTCGAGAATAGGTGTCCAAAGGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023279.2-635s21c1
Sequence:CCGGAGACCTACTGCATCGACAATGCTCGAGCATTGTCGATGCAGTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023279.2-1528s21c1
Sequence:CCGGGGTTAAAGTCCTTCAGTATTTCTCGAGAAATACTGAAGGACTTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023279
TUBB3 MISSION shRNA shRNA Plasmid DNA
tubulin, beta 3 class III
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023279.2-1605s1c1
Sequence:CCGGCCTCTGTATTTATGTTGCTTACTCGAGTAAGCAACATAAATACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-399s1c1
Sequence:CCGGCGTGCGGAAAGAGTGTGAGAACTCGAGTTCTCACACTCTTTCCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-1041s1c1
Sequence:CCGGCCAGAGTAAGAACAGCAGCTACTCGAGTAGCTGCTGTTCTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-297s1c1
Sequence:CCGGCAGGCCCGACAACTTTATCTTCTCGAGAAGATAAAGTTGTCGGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-298s1c1
Sequence:CCGGAGGCCCGACAACTTTATCTTTCTCGAGAAAGATAAAGTTGTCGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023279.2-341s21c1
Sequence:CCGGACTGGGCCAAAGGGCACTATACTCGAGTATAGTGCCCTTTGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023279.2-276s21c1
Sequence:CCGGTGGCGCCTTTGGACACCTATTCTCGAGAATAGGTGTCCAAAGGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023279.2-635s21c1
Sequence:CCGGAGACCTACTGCATCGACAATGCTCGAGCATTGTCGATGCAGTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023279.2-1528s21c1
Sequence:CCGGGGTTAAAGTCCTTCAGTATTTCTCGAGAAATACTGAAGGACTTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023279
TUBB3 MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 3 class III
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023279.2-1605s1c1
Sequence:CCGGCCTCTGTATTTATGTTGCTTACTCGAGTAAGCAACATAAATACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-399s1c1
Sequence:CCGGCGTGCGGAAAGAGTGTGAGAACTCGAGTTCTCACACTCTTTCCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-1041s1c1
Sequence:CCGGCCAGAGTAAGAACAGCAGCTACTCGAGTAGCTGCTGTTCTTACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-297s1c1
Sequence:CCGGCAGGCCCGACAACTTTATCTTCTCGAGAAGATAAAGTTGTCGGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023279.2-298s1c1
Sequence:CCGGAGGCCCGACAACTTTATCTTTCTCGAGAAAGATAAAGTTGTCGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023279.2-341s21c1
Sequence:CCGGACTGGGCCAAAGGGCACTATACTCGAGTATAGTGCCCTTTGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023279.2-276s21c1
Sequence:CCGGTGGCGCCTTTGGACACCTATTCTCGAGAATAGGTGTCCAAAGGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023279.2-635s21c1
Sequence:CCGGAGACCTACTGCATCGACAATGCTCGAGCATTGTCGATGCAGTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023279.2-1528s21c1
Sequence:CCGGGGTTAAAGTCCTTCAGTATTTCTCGAGAAATACTGAAGGACTTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks