EMAIL THIS PAGE TO A FRIEND

TUBB4B

tubulin, beta 4B class IVb

Synonyms: Beta2 TUBB2 TUBB2C
UniProtKB ID: P68371, A2BFA2, P05217
Gene ID:
Mouse(227613) tubulin, beta 4B class IVB
Rat(296554) tubulin, beta 4B class IVb
Zebrafish(336681) tubulin, beta 4B class IVb
domestic cat(101084324) tubulin, beta 4B class IVb
dog(491231) tubulin, beta 4B class IVb
cow(539149) tubulin, beta 2C
sheep(101108730) tubulin, beta 4B class IVb
domestic guinea pig(100728260) tubulin, beta 4B class IVb
naked mole-rat(101712490) tubulin, beta 4B class IVb
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2702391 Anti-beta Tululin 2C [C1C3] antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB2702390 Anti-beta Tululin 2C [N2C2], Internal antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB2701624 Anti-tubb2c antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701786 Anti-tubb2c antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
T3526 Anti-Tubulin antibody produced in rabbit whole antiserum mouse, chicken
immunofluorescence, western blot pricing
T0198 Monoclonal Anti-β-Tubulin antibody produced in mouse clone D66, purified from hybridoma cell culture Chlamydomonas reinhardtii, canine, rabbit, sea urchin (Lytechinus pictus and Paracentrotus lividus), bovine, hamster, rat, chicken, human, monkey, mouse, Oxyrrhis marina (dinoflagellate)
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
T4026 Monoclonal Anti-β-Tubulin antibody produced in mouse clone TUB 2.1, ascites fluid chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunofluorescence, western blot pricing
T5293 Monoclonal Anti-β-Tubulin antibody produced in mouse clone 2-28-33, ascites fluid rat, chicken, bovine, Caenorhabditis elegans, Strongylocentrotus purpuratus, Ciona intestinalis, human
immunofluorescence, western blot pricing
T5201 Monoclonal Anti-β-Tubulin antibody produced in mouse clone TUB 2.1, purified from hybridoma cell culture chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunoelectrophoresis, immunofluorescence, immunohistochemistry, microarray, western blot pricing
T8535 Monoclonal Anti-β-Tubulin I+II antibody produced in mouse clone JDR.3B8, ascites fluid pig, mouse, rat, chicken, human, bovine
ELISA, immunofluorescence, microarray, western blot pricing
C4585 Monoclonal Anti-β-Tubulin−Cy3 antibody produced in mouse clone TUB 2.1, purified immunoglobulin, buffered aqueous solution chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunofluorescence pricing
F2043 Monoclonal Anti-β-Tubulin−FITC antibody produced in mouse clone TUB 2.1, purified immunoglobulin, buffered aqueous solution chicken, human, frog, wheat, plant, rabbit, bovine, mouse, hamster, moth, rat, sea urchin
immunofluorescence pricing
SAB1404819 Monoclonal Anti-TUBB2 antibody produced in mouse clone 1F9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
WH0010383M2 Monoclonal Anti-TUBB2C antibody produced in mouse clone 1G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing
AQ0079 AQUA Peptide YLTVAAVF[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat, sheep pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006088 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006088 Rosetta Predictions human pricing
NM_199094 Rosetta Predictions rat pricing
NM_146116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193802 predicted 343
2 SASI_Hs01_00193804 predicted 592
3 SASI_Hs01_00193807 predicted 1069
4 SASI_Hs01_00193808 predicted 1076
5 SASI_Hs02_00340867 predicted 536
6 SASI_Hs01_00193803 predicted 715
7 SASI_Hs01_00193805 predicted 724
8 SASI_Hs01_00193809 predicted 1084
9 SASI_Hs01_00193806 predicted 707
10 SASI_Hs01_00193810 predicted 1459
11 SASI_Hs01_00193811 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109567 predicted 564
2 SASI_Rn01_00109569 predicted 920
3 SASI_Rn02_00270104 predicted 667
4 SASI_Rn02_00270105 predicted 545
5 SASI_Rn01_00109565 predicted 722
6 SASI_Rn01_00109566 predicted 727
7 SASI_Rn01_00109568 predicted 825
8 SASI_Rn02_00270106 predicted 532
9 SASI_Rn02_00270107 predicted 507
10 SASI_Rn02_00270108 predicted 651
11 SASI_Rn01_00109570 predicted 817
12 SASI_Rn01_00109571 predicted 432
13 SASI_Rn01_00109572 predicted 746
14 SASI_Rn01_00109573 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159587 predicted 294
2 SASI_Mm02_00341779 predicted 1166
3 SASI_Mm01_00159589 predicted 793
4 SASI_Mm01_00159590 predicted 665
5 SASI_Mm01_00159591 predicted 542
6 SASI_Mm01_00159592 predicted 1161
7 SASI_Mm01_00159593 predicted 613
8 SASI_Mm01_00159594 predicted 302
9 SASI_Mm01_00159595 predicted 803
10 SASI_Mm01_00159596 predicted 602
11 SASI_Mm01_00159588 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006088
VALIDATED
TUBB4B MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 4B class IVb
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006088.5-729s1c1
Sequence:CCGGCATTTGCTTCAGAACCCTAAACTCGAGTTTAGGGTTCTGAAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006088.5-446s1c1
Sequence:CCGGCGGTGCTGGATGTTGTGAGAACTCGAGTTCTCACAACATCCAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006088.5-722s1c1
Sequence:CCGGTCTACGACATTTGCTTCAGAACTCGAGTTCTGAAGCAAATGTCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006088.5-238s1c1
Sequence:CCGGCGCATCAACGTGTACTACAATCTCGAGATTGTAGTACACGTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006088.5-1078s1c1
Sequence:CCGGGTGGATGAGCAAATGCTTAATCTCGAGATTAAGCATTTGCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-446s21c1
Sequence:CCGGCGGTGCTGGATGTTGTGAGAACTCGAGTTCTCACAACATCCAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-729s21c1
Sequence:CCGGCATTTGCTTCAGAACCCTAAACTCGAGTTTAGGGTTCTGAAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-1078s21c1
Sequence:CCGGGTGGATGAGCAAATGCTTAATCTCGAGATTAAGCATTTGCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-238s21c1
Sequence:CCGGCGCATCAACGTGTACTACAATCTCGAGATTGTAGTACACGTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006088
VALIDATED
TUBB4B MISSION shRNA shRNA Plasmid DNA
tubulin, beta 4B class IVb
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006088.5-729s1c1
Sequence:CCGGCATTTGCTTCAGAACCCTAAACTCGAGTTTAGGGTTCTGAAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006088.5-446s1c1
Sequence:CCGGCGGTGCTGGATGTTGTGAGAACTCGAGTTCTCACAACATCCAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006088.5-722s1c1
Sequence:CCGGTCTACGACATTTGCTTCAGAACTCGAGTTCTGAAGCAAATGTCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006088.5-238s1c1
Sequence:CCGGCGCATCAACGTGTACTACAATCTCGAGATTGTAGTACACGTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006088.5-1078s1c1
Sequence:CCGGGTGGATGAGCAAATGCTTAATCTCGAGATTAAGCATTTGCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-446s21c1
Sequence:CCGGCGGTGCTGGATGTTGTGAGAACTCGAGTTCTCACAACATCCAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-729s21c1
Sequence:CCGGCATTTGCTTCAGAACCCTAAACTCGAGTTTAGGGTTCTGAAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-1078s21c1
Sequence:CCGGGTGGATGAGCAAATGCTTAATCTCGAGATTAAGCATTTGCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-238s21c1
Sequence:CCGGCGCATCAACGTGTACTACAATCTCGAGATTGTAGTACACGTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006088
VALIDATED
TUBB4B MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 4B class IVb
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006088.5-729s1c1
Sequence:CCGGCATTTGCTTCAGAACCCTAAACTCGAGTTTAGGGTTCTGAAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006088.5-446s1c1
Sequence:CCGGCGGTGCTGGATGTTGTGAGAACTCGAGTTCTCACAACATCCAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006088.5-722s1c1
Sequence:CCGGTCTACGACATTTGCTTCAGAACTCGAGTTCTGAAGCAAATGTCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006088.5-238s1c1
Sequence:CCGGCGCATCAACGTGTACTACAATCTCGAGATTGTAGTACACGTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006088.5-1078s1c1
Sequence:CCGGGTGGATGAGCAAATGCTTAATCTCGAGATTAAGCATTTGCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-446s21c1
Sequence:CCGGCGGTGCTGGATGTTGTGAGAACTCGAGTTCTCACAACATCCAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-729s21c1
Sequence:CCGGCATTTGCTTCAGAACCCTAAACTCGAGTTTAGGGTTCTGAAGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-1078s21c1
Sequence:CCGGGTGGATGAGCAAATGCTTAATCTCGAGATTAAGCATTTGCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006088.5-238s21c1
Sequence:CCGGCGCATCAACGTGTACTACAATCTCGAGATTGTAGTACACGTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146116
VALIDATED
TUBB4B MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 4B class IVb
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146116.1-921s1c1
Sequence:CCGGCCAGCAGATGTTTGATGCCAACTCGAGTTGGCATCAAACATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146116.1-297s1c1
Sequence:CCGGGCAGATCTTCAGACCTGATAACTCGAGTTATCAGGTCTGAAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146116.1-1168s1c1
Sequence:CCGGGCTATTCAGGAGCTGTTCAAACTCGAGTTTGAACAGCTCCTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146116.1-1391s1c1
Sequence:CCGGGCTGTCTTAGTCACTAAAGCACTCGAGTGCTTTAGTGACTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146116.1-186s1c1
Sequence:CCGGGCGCATCAACGTGTACTACAACTCGAGTTGTAGTACACGTTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146116
VALIDATED
TUBB4B MISSION shRNA shRNA Plasmid DNA
tubulin, beta 4B class IVb
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146116.1-921s1c1
Sequence:CCGGCCAGCAGATGTTTGATGCCAACTCGAGTTGGCATCAAACATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146116.1-297s1c1
Sequence:CCGGGCAGATCTTCAGACCTGATAACTCGAGTTATCAGGTCTGAAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146116.1-1168s1c1
Sequence:CCGGGCTATTCAGGAGCTGTTCAAACTCGAGTTTGAACAGCTCCTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146116.1-1391s1c1
Sequence:CCGGGCTGTCTTAGTCACTAAAGCACTCGAGTGCTTTAGTGACTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146116.1-186s1c1
Sequence:CCGGGCGCATCAACGTGTACTACAACTCGAGTTGTAGTACACGTTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146116
VALIDATED
TUBB4B MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 4B class IVb
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146116.1-921s1c1
Sequence:CCGGCCAGCAGATGTTTGATGCCAACTCGAGTTGGCATCAAACATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146116.1-297s1c1
Sequence:CCGGGCAGATCTTCAGACCTGATAACTCGAGTTATCAGGTCTGAAGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146116.1-1168s1c1
Sequence:CCGGGCTATTCAGGAGCTGTTCAAACTCGAGTTTGAACAGCTCCTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146116.1-1391s1c1
Sequence:CCGGGCTGTCTTAGTCACTAAAGCACTCGAGTGCTTTAGTGACTAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146116.1-186s1c1
Sequence:CCGGGCGCATCAACGTGTACTACAACTCGAGTTGTAGTACACGTTGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks