EMAIL THIS PAGE TO A FRIEND

TUBB6

tubulin, beta 6 class V

Synonyms: HsT1601 TUBB-5
UniProtKB ID: Q9BUF5, B3KM76, Q9HA42
Gene ID:
Mouse(67951) tubulin, beta 6 class V
Rat(307351) tubulin, beta 6 class V
naked mole-rat(101720443) tubulin, beta 6 class V
cow(534206) tubulin, beta 6 class V
sheep(101106224) tubulin, beta 6 class V
chicken(421037) tubulin, beta 6 class V
dog(480213) tubulin, beta 6 class V
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302281 ANTI-TUBB6 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2108439 Anti-TUBB6 antibody produced in rabbit affinity isolated antibody guinea pig, human, rabbit, horse, yeast
western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing
AQ0079 AQUA Peptide YLTVAAVF[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat, sheep pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032525 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044771 MISSION® esiRNA esiRNA human TUBB6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032525 Rosetta Predictions human pricing
NM_001025675 Rosetta Predictions rat pricing
NM_026473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131377 predicted 1460
2 SASI_Hs01_00131378 predicted 1512
3 SASI_Hs01_00131379 predicted 1556
4 SASI_Hs01_00131380 predicted 1394
5 SASI_Hs01_00131381 predicted 1415
6 SASI_Hs01_00131382 predicted 1596
7 SASI_Hs01_00131383 predicted 1464
8 SASI_Hs01_00131384 predicted 1599
9 SASI_Hs01_00131385 predicted 1460
10 SASI_Hs01_00131386 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077900 predicted 1408
2 SASI_Rn01_00077902 predicted 699
3 SASI_Rn01_00077903 predicted 304
4 SASI_Rn01_00077904 predicted 524
5 SASI_Rn01_00077905 predicted 1144
6 SASI_Rn02_00203276 predicted 748
7 SASI_Rn02_00203277 predicted 1155
8 SASI_Rn02_00203278 predicted 749
9 SASI_Rn01_00077908 predicted 1574
10 SASI_Rn01_00077909 predicted 1528
11 SASI_Rn01_00077901 predicted 900
12 SASI_Rn01_00077906 predicted 282
13 SASI_Rn01_00077907 predicted 187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116333 predicted 303
2 SASI_Mm01_00116334 predicted 705
3 SASI_Mm01_00116335 predicted 247
4 SASI_Mm01_00116336 predicted 392
5 SASI_Mm01_00116337 predicted 746
6 SASI_Mm01_00116338 predicted 1490
7 SASI_Mm01_00116339 predicted 1361
8 SASI_Mm01_00116340 predicted 386
9 SASI_Mm01_00116341 predicted 1355
10 SASI_Mm01_00116342 predicted 1331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026473
VALIDATED
TUBB6 MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 6 class V
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026473.2-1375s1c1
Sequence:CCGGGCCATAAGATGCTACAGTGAACTCGAGTTCACTGTAGCATCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-1330s1c1
Sequence:CCGGGAGGCATTTGAAGACGAGGATCTCGAGATCCTCGTCTTCAAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-170s1c1
Sequence:CCGGGCGTCTACTACAATGAGTCATCTCGAGATGACTCATTGTAGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-177s1c1
Sequence:CCGGCTACAATGAGTCATCCTCTAACTCGAGTTAGAGGATGACTCATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-732s1c1
Sequence:CCGGTGTCACCACATCACTGCGTTTCTCGAGAAACGCAGTGATGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026473.2-170s21c1
Sequence:CCGGGCGTCTACTACAATGAGTCATCTCGAGATGACTCATTGTAGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026473.2-1330s21c1
Sequence:CCGGGAGGCATTTGAAGACGAGGATCTCGAGATCCTCGTCTTCAAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026473.2-732s21c1
Sequence:CCGGTGTCACCACATCACTGCGTTTCTCGAGAAACGCAGTGATGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026473.2-1375s21c1
Sequence:CCGGGCCATAAGATGCTACAGTGAACTCGAGTTCACTGTAGCATCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026473
VALIDATED
TUBB6 MISSION shRNA shRNA Plasmid DNA
tubulin, beta 6 class V
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026473.2-1375s1c1
Sequence:CCGGGCCATAAGATGCTACAGTGAACTCGAGTTCACTGTAGCATCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-1330s1c1
Sequence:CCGGGAGGCATTTGAAGACGAGGATCTCGAGATCCTCGTCTTCAAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-170s1c1
Sequence:CCGGGCGTCTACTACAATGAGTCATCTCGAGATGACTCATTGTAGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-177s1c1
Sequence:CCGGCTACAATGAGTCATCCTCTAACTCGAGTTAGAGGATGACTCATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-732s1c1
Sequence:CCGGTGTCACCACATCACTGCGTTTCTCGAGAAACGCAGTGATGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026473.2-170s21c1
Sequence:CCGGGCGTCTACTACAATGAGTCATCTCGAGATGACTCATTGTAGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026473.2-1330s21c1
Sequence:CCGGGAGGCATTTGAAGACGAGGATCTCGAGATCCTCGTCTTCAAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026473.2-732s21c1
Sequence:CCGGTGTCACCACATCACTGCGTTTCTCGAGAAACGCAGTGATGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026473.2-1375s21c1
Sequence:CCGGGCCATAAGATGCTACAGTGAACTCGAGTTCACTGTAGCATCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026473
VALIDATED
TUBB6 MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 6 class V
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026473.2-1375s1c1
Sequence:CCGGGCCATAAGATGCTACAGTGAACTCGAGTTCACTGTAGCATCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-1330s1c1
Sequence:CCGGGAGGCATTTGAAGACGAGGATCTCGAGATCCTCGTCTTCAAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-170s1c1
Sequence:CCGGGCGTCTACTACAATGAGTCATCTCGAGATGACTCATTGTAGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-177s1c1
Sequence:CCGGCTACAATGAGTCATCCTCTAACTCGAGTTAGAGGATGACTCATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026473.2-732s1c1
Sequence:CCGGTGTCACCACATCACTGCGTTTCTCGAGAAACGCAGTGATGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026473.2-170s21c1
Sequence:CCGGGCGTCTACTACAATGAGTCATCTCGAGATGACTCATTGTAGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026473.2-1330s21c1
Sequence:CCGGGAGGCATTTGAAGACGAGGATCTCGAGATCCTCGTCTTCAAATGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026473.2-732s21c1
Sequence:CCGGTGTCACCACATCACTGCGTTTCTCGAGAAACGCAGTGATGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026473.2-1375s21c1
Sequence:CCGGGCCATAAGATGCTACAGTGAACTCGAGTTCACTGTAGCATCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032525
TUBB6 MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 6 class V
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032525.1-1581s1c1
Sequence:CCGGCCAGTCAGAAGATCACACCATCTCGAGATGGTGTGATCTTCTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-301s1c1
Sequence:CCGGCGGCCTGACAACTTCATCTTTCTCGAGAAAGATGAAGTTGTCAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-1047s1c1
Sequence:CCGGGAGTAAGAACAGCAGCTACTTCTCGAGAAGTAGCTGCTGTTCTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-209s1c1
Sequence:CCGGCGTCTCAGAAATATGTGCCCACTCGAGTGGGCACATATTTCTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-198s1c1
Sequence:CCGGCAATGAGTCATCGTCTCAGAACTCGAGTTCTGAGACGATGACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032525.1-1374s21c1
Sequence:CCGGGATCGATGGATAGTCGGAATACTCGAGTATTCCGACTATCCATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032525.1-1650s21c1
Sequence:CCGGTAAACTTCACCTTCCATTAAGCTCGAGCTTAATGGAAGGTGAAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032525.1-1513s21c1
Sequence:CCGGTGCAGCCAAGTCATGTAATTACTCGAGTAATTACATGACTTGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032525
TUBB6 MISSION shRNA shRNA Plasmid DNA
tubulin, beta 6 class V
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032525.1-1581s1c1
Sequence:CCGGCCAGTCAGAAGATCACACCATCTCGAGATGGTGTGATCTTCTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-301s1c1
Sequence:CCGGCGGCCTGACAACTTCATCTTTCTCGAGAAAGATGAAGTTGTCAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-1047s1c1
Sequence:CCGGGAGTAAGAACAGCAGCTACTTCTCGAGAAGTAGCTGCTGTTCTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-209s1c1
Sequence:CCGGCGTCTCAGAAATATGTGCCCACTCGAGTGGGCACATATTTCTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-198s1c1
Sequence:CCGGCAATGAGTCATCGTCTCAGAACTCGAGTTCTGAGACGATGACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032525.1-1374s21c1
Sequence:CCGGGATCGATGGATAGTCGGAATACTCGAGTATTCCGACTATCCATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032525.1-1650s21c1
Sequence:CCGGTAAACTTCACCTTCCATTAAGCTCGAGCTTAATGGAAGGTGAAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032525.1-1513s21c1
Sequence:CCGGTGCAGCCAAGTCATGTAATTACTCGAGTAATTACATGACTTGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032525
TUBB6 MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 6 class V
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032525.1-1581s1c1
Sequence:CCGGCCAGTCAGAAGATCACACCATCTCGAGATGGTGTGATCTTCTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-301s1c1
Sequence:CCGGCGGCCTGACAACTTCATCTTTCTCGAGAAAGATGAAGTTGTCAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-1047s1c1
Sequence:CCGGGAGTAAGAACAGCAGCTACTTCTCGAGAAGTAGCTGCTGTTCTTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-209s1c1
Sequence:CCGGCGTCTCAGAAATATGTGCCCACTCGAGTGGGCACATATTTCTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032525.1-198s1c1
Sequence:CCGGCAATGAGTCATCGTCTCAGAACTCGAGTTCTGAGACGATGACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032525.1-1374s21c1
Sequence:CCGGGATCGATGGATAGTCGGAATACTCGAGTATTCCGACTATCCATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032525.1-1650s21c1
Sequence:CCGGTAAACTTCACCTTCCATTAAGCTCGAGCTTAATGGAAGGTGAAGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032525.1-1513s21c1
Sequence:CCGGTGCAGCCAAGTCATGTAATTACTCGAGTAATTACATGACTTGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks