EMAIL THIS PAGE TO A FRIEND

TUBB7P

tubulin, beta 7, pseudogene

Synonyms: TUBB4Q
Species: Human TUBB7P(56604)
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020040 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020040 Rosetta Predictions human pricing
XM_001713864 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352944 predicted 599
2 SASI_Hs02_00352945 predicted 609
3 SASI_Hs01_00214622 predicted 438
4 SASI_Hs02_00352946 predicted 132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393436 predicted 943
2 SASI_Hs02_00393437 predicted 975
3 SASI_Hs02_00393438 predicted 1028
4 SASI_Hs02_00393439 predicted 1195
5 SASI_Hs02_00393440 predicted 1195
6 SASI_Hs02_00393441 predicted 1169
7 SASI_Hs02_00393442 predicted 1208
8 SASI_Hs02_00393443 predicted 1311
9 SASI_Hs02_00393444 predicted 1374
10 SASI_Hs02_00393445 predicted 1308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020040
TUBB7P MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 7, pseudogene
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020040.3-1124s21c1
Sequence:CCGGAGGAACTCAAGCGGGTCTCAGCTCGAGCTGAGACCCGCTTGAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020040.3-1113s21c1
Sequence:CCGGCACAGCCGTCCAGGAACTCAACTCGAGTTGAGTTCCTGGACGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-259s1c1
Sequence:CCGGCCAGACAACTTCATTTCCCGTCTCGAGACGGGAAATGAAGTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-495s1c1
Sequence:CCGGCACATTGAGCATCCTGCTCTTCTCGAGAAGAGCAGGATGCTCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-760s1c1
Sequence:CCGGGCCATGAACATGGTCCCGTTTCTCGAGAAACGGGACCATGTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-982s1c1
Sequence:CCGGGAACAGATGTTCAACATTCAACTCGAGTTGAATGTTGAACATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-602s1c1
Sequence:CCGGGCATAGATAACGAAGCGCTATCTCGAGATAGCGCTTCGTTATCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020040
TUBB7P MISSION shRNA shRNA Plasmid DNA
tubulin, beta 7, pseudogene
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020040.3-1124s21c1
Sequence:CCGGAGGAACTCAAGCGGGTCTCAGCTCGAGCTGAGACCCGCTTGAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020040.3-1113s21c1
Sequence:CCGGCACAGCCGTCCAGGAACTCAACTCGAGTTGAGTTCCTGGACGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-259s1c1
Sequence:CCGGCCAGACAACTTCATTTCCCGTCTCGAGACGGGAAATGAAGTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-495s1c1
Sequence:CCGGCACATTGAGCATCCTGCTCTTCTCGAGAAGAGCAGGATGCTCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-760s1c1
Sequence:CCGGGCCATGAACATGGTCCCGTTTCTCGAGAAACGGGACCATGTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-982s1c1
Sequence:CCGGGAACAGATGTTCAACATTCAACTCGAGTTGAATGTTGAACATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-602s1c1
Sequence:CCGGGCATAGATAACGAAGCGCTATCTCGAGATAGCGCTTCGTTATCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020040
TUBB7P MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 7, pseudogene
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020040.3-1124s21c1
Sequence:CCGGAGGAACTCAAGCGGGTCTCAGCTCGAGCTGAGACCCGCTTGAGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020040.3-1113s21c1
Sequence:CCGGCACAGCCGTCCAGGAACTCAACTCGAGTTGAGTTCCTGGACGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-259s1c1
Sequence:CCGGCCAGACAACTTCATTTCCCGTCTCGAGACGGGAAATGAAGTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-495s1c1
Sequence:CCGGCACATTGAGCATCCTGCTCTTCTCGAGAAGAGCAGGATGCTCAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-760s1c1
Sequence:CCGGGCCATGAACATGGTCCCGTTTCTCGAGAAACGGGACCATGTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-982s1c1
Sequence:CCGGGAACAGATGTTCAACATTCAACTCGAGTTGAATGTTGAACATCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020040.3-602s1c1
Sequence:CCGGGCATAGATAACGAAGCGCTATCTCGAGATAGCGCTTCGTTATCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks