EMAIL THIS PAGE TO A FRIEND

TUBB8

tubulin, beta 8 class VIII

Synonyms: bA631M21.2
Species: Human TUBB8(347688)
UniProtKB ID: Q3ZCM7, Q5SQX9, Q8WZ78
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177987 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177987 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234325 predicted 610
2 SASI_Hs01_00234326 predicted 433
3 SASI_Hs01_00234327 predicted 606
4 SASI_Hs01_00234328 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177987
TUBB8 MISSION shRNA Bacterial Glycerol Stock
tubulin, beta 8 class VIII
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-760s1c1
Sequence:CCGGGCCGTGAACATGGTCCCGTTTCTCGAGAAACGGGACCATGTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-1093s1c1
Sequence:CCGGGCCACCTTCATTGGGAATAATCTCGAGATTATTCCCAATGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-869s1c1
Sequence:CCGGCCCAGCAGATGTTTGATGCTACTCGAGTAGCATCAAACATCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-443s1c1
Sequence:CCGGGTACCCTTCTGCTCAGTAAGACTCGAGTCTTACTGAGCAGAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-870s1c1
Sequence:CCGGCCAGCAGATGTTTGATGCTAACTCGAGTTAGCATCAAACATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-133s21c1
Sequence:CCGGGAGCGCATCAACGTGTACTACCTCGAGGTAGTACACGTTGATGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-611s21c1
Sequence:CCGGACGAAGCTCTGTATGACATATCTCGAGATATGTCATACAGAGCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1136s21c1
Sequence:CCGGAGCGTGTCTCAGAGCAGTTTACTCGAGTAAACTGCTCTGAGACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1004s21c1
Sequence:CCGGATAAGAACAGCAGTTACTTTGCTCGAGCAAAGTAACTGCTGTTCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177987
TUBB8 MISSION shRNA shRNA Plasmid DNA
tubulin, beta 8 class VIII
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-760s1c1
Sequence:CCGGGCCGTGAACATGGTCCCGTTTCTCGAGAAACGGGACCATGTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-1093s1c1
Sequence:CCGGGCCACCTTCATTGGGAATAATCTCGAGATTATTCCCAATGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-869s1c1
Sequence:CCGGCCCAGCAGATGTTTGATGCTACTCGAGTAGCATCAAACATCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-443s1c1
Sequence:CCGGGTACCCTTCTGCTCAGTAAGACTCGAGTCTTACTGAGCAGAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-870s1c1
Sequence:CCGGCCAGCAGATGTTTGATGCTAACTCGAGTTAGCATCAAACATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-133s21c1
Sequence:CCGGGAGCGCATCAACGTGTACTACCTCGAGGTAGTACACGTTGATGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-611s21c1
Sequence:CCGGACGAAGCTCTGTATGACATATCTCGAGATATGTCATACAGAGCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1136s21c1
Sequence:CCGGAGCGTGTCTCAGAGCAGTTTACTCGAGTAAACTGCTCTGAGACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1004s21c1
Sequence:CCGGATAAGAACAGCAGTTACTTTGCTCGAGCAAAGTAACTGCTGTTCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177987
TUBB8 MISSION shRNA Lentiviral Transduction Particles
tubulin, beta 8 class VIII
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-760s1c1
Sequence:CCGGGCCGTGAACATGGTCCCGTTTCTCGAGAAACGGGACCATGTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-1093s1c1
Sequence:CCGGGCCACCTTCATTGGGAATAATCTCGAGATTATTCCCAATGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-869s1c1
Sequence:CCGGCCCAGCAGATGTTTGATGCTACTCGAGTAGCATCAAACATCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-443s1c1
Sequence:CCGGGTACCCTTCTGCTCAGTAAGACTCGAGTCTTACTGAGCAGAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177987.1-870s1c1
Sequence:CCGGCCAGCAGATGTTTGATGCTAACTCGAGTTAGCATCAAACATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-133s21c1
Sequence:CCGGGAGCGCATCAACGTGTACTACCTCGAGGTAGTACACGTTGATGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-611s21c1
Sequence:CCGGACGAAGCTCTGTATGACATATCTCGAGATATGTCATACAGAGCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1136s21c1
Sequence:CCGGAGCGTGTCTCAGAGCAGTTTACTCGAGTAAACTGCTCTGAGACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177987.2-1004s21c1
Sequence:CCGGATAAGAACAGCAGTTACTTTGCTCGAGCAAAGTAACTGCTGTTCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks